Beauveria bassiana (Balsamo) Vuillemin (ATCC® 7159)

Strain Designations: CBS 209.27 [DSM 1344]  /  Product Format: freeze-dried

Permits and Restrictions

View Permits

Deposited As Sporotrichum sulfurescens van Beyma
Strain Designations CBS 209.27 [DSM 1344]
Application
Hydrolyzes 1,2-dihydronaphthalene
Hydrolyzes 1,2-epoxyindene
Hydrolyzes styrene oxide
Hydroxylates polycyclic enones
Metabolizes phencyclidine
Oxidizes arteether
Oxidizes dialkylbenzen Hydroxylates e
Produces 2-deuterio-cycloalkanones
Produces 3-deuterio-cycloalkanones
Produces carbomycin derivatives magnamycin derivatives
Produces hydroxymethylpyridines (isomeric)
Produces leucomycin derivatives
Produces niddamycin derivatives
Hydroxylation of 7-azabrendane and 6-azatwistane derivatives
Hydroxylation of synthetic polycyclic enones
Reduction of alpha, beta-unsaturated ketones
Converts isosorbide dinitrate to isosorbide 5-mononitrate
Transformation of pergolide to pergolide sulfoxide
Glycosylation of 2,2,5,7,8-pentamethyl-6-hydroxychroman
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain yes (type strain of Sporotrichum sulfurescens)
Preceptrol® no
Medium ATCC® Medium 200: YM agar or YM broth
ATCC® Medium 324: Malt extract agar
ATCC® Medium 336: Potato dextrose agar (PDA)
Growth Conditions
Temperature: 24°C to 26°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

GGTCTCCGTTGGTGAACCAGCGGAGGGATCATTACCGAGTTTTCAACTCCCTAACCCTTCTGTGAACCTACCTATCGTTGCTTCGGCGGACTCGCCCCAGCCCGGACGCGGACTGGACCAGCGGCCCGCCGGGGACCTCAAACTCTTGTATTCCAGCATCTTCTGAATACGCCGCAAGGCAAAACAAATGAATCAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAACGCGATAAGTAATGTGAATTGCAGAATCCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCGACCTCCCCTTGGGGAGGTCGGCGTTGGGGACCGGCAGCACACCGCCGGCCCTGAAATGGAGTGGCGGCCCGTCCGCGGCGACCTCTGCGCAGTAATACAGCTCGCACCGGAACCCCGACGCGGCCACGCCGTAAAACACCCAACTTCTGAACGTTGACCTCGAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAA


D1D2 region of the 28S ribosomal RNA gene

ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTCAGGGCCCGAGTTGTAATTTGTAGAGGATGCTTTTGGCGAGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTATGGTCGGACACCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTATATGTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCCTATGACCAGACTTGCGCCCGGTGAATCACCCAGCGTTCTCGCTGGTGCACTTTGCCGGGCACAGGCCAGCATCAGTTCAGCGCGGGGGAGAAAGGCTTCGGGAATGTGGCTCCCTCGGGAGTGTTATAGCCCGCTGCGTAATGCCCTGCGCCGGACTGAGGTACGCGCATTGCAAGGATGCTGGCGTAATGGTCATCAGCGAC


RNA polymerase II largest subunit gene (RPB1)

CCATATAGAGCTGGCGAAACCTGTCTATCACCCTGGTTTCATCAAGAAAGTGAAAAAGGTTTTGGAGATTGTCTGCCACAACTGCAGCAAAGTGTTGGCCGATGAAGTTGGTCTTCCCTTTACTCCATGAAGCTCTGGAGCTTGCTGGATGCTAACGTGCATTATCAGAGCGATCCCGAATTCGTCACAGCTATTCATACTCGCGATCCGAAACTCCGATTCAAGCGCGTTTGGGCCGTATGCAAGAAGAAGCGCAAATGCGAGAATGAGGAGCGGCAAGACAAGAATAAAGACGAAGAGTTCGCTCCAGGTGTCAAGAACGTCGTTCTCGAAGGACATGGCGGATGTGGCAATATGCAGCCGCAGGTGAGACAGGCCGCGCTGCAACTCAAAGCTGCCTTCGAGGTTACTTCGGAAGAGGGTCCCAAGAGGAAAGAGACGGTTAATATCAGCGCCGAGATGGCGCATGGTATCCTTCGCCGCATCTCTGAGCGCGATCTGCACAATATTGGTCTTAACTCAGACTATGCTCGTCCCGAGTGGATGATCATCACTGTCCTGCCTGTACCCCCTCCTCCCGTGCGTCCTAGTATTTCCATGGATGGTACTGGTACTGGCACGAGAAACGAGGATGATCTGACCTACAAGCTTGGTGACATTATCCGCGCCAACGGAAATGTCAAGCAGGCCATTCGTGAAGGATCACCGCAACACATCGCGCGTGATTTTGAGGAGCTGCTGCAGTACCATGTTGCCACC

Name of Depositor CBS
Chain of Custody
ATCC <-- CBS <-- F.H. van Beyma
Isolation
Laboratory contaminant
References

Ropenga JS, et al. Isosorbide dinitrate bioconversion by Beauveria strains: implication of glutathione transferase levels. Appl. Microbiol. Biotechnol. 31: 176-178, 1989.

Pedragosa-Moreau S, et al. Microbiological transformations. 28. Enantiocomplementary epoxide hydrolyses as a preparative access to both enantiomers of styrene oxide. J. Org. Chem. 58: 5533-5536, 1993.

Theriault RJ. Mycarosyl macrolide antibiotics. US Patent 3,784,447 dated Jan 8 1974

Taylor JJ. Further clarification of Sporotrichum species. Mycologia 62: 823, 1970.

Johnson RA, et al. Microbial oxygenation of dialkylbenzenes. Bioorg Chem 2: 99-110, 1973.

Kergomard A, et al. Microbiological reduction of alpha,beta-unsaturated ketones by Beauveria sulfurescens. J. Org. Chem. 47: 792-798, 1982.

Hu Y, et al. Microbial oxidataion of the antimalarial drug arteether. Bioorg. Chem. 20: 148-154, 1992.

Hufford CD, et al. Metabolism of phencyclidine by microorganisms. J. Pharm. Sci. 70: 155-158, 1981. PubMed: 7205218

Furstoss R, et al. Microbiological transformations 2. Hydroxylations of non activated carbons in globular type amides. Tetrahedron Lett 22: 445-448, 1981.

Dauphin G, et al. Microbiological synthesis and circular dichroism of optically active 2-deuterio-cycloalkanones. Tetrahedron Lett 21: 4275-4278, 1980.

Pedragosa-Moreau S, et al. Microbiological transformations. 31: Synthesis of enantiopure epoxides and vicinal diols using fungal epoxide hydrolase mediated hydrolysis. Tetrahedron Lett. 37: 3319-3322, 1996.

Dauphin G, et al. Microbial glycosylation of 2, 2, 5, 7, 8-pentamethyl- 6-hydroxychroman. Agric Biol Chem 53: 1433-1435, 1989.

Dauphin G, et al. Microbiological synthesis of optically active 3-deuterio-cycloalkanones. J. Chem. Soc. Chem. Commun. 1980: 318-319, 1980.

Smith RV, et al. Microbial transformations of pergolide to pergolide sulfoxide and pergolide sulfone. J. Pharm. Sci. 72: 733-736, 1983. PubMed: 6684155

Modyanova LV, et al. Microbial transformation of nitrogen-containing heterocyclic compounds. I. Hydroxylation of isomeric monomethylpyridines and dimethylpyridines by microscopic fungi. Biotekhnologiya 3: 24-27, 1990.

Hammoumi A, et al. Microbial hydroxylation and functionalization of synthetic polycyclic enones. Tetrahedron Asymmetry 4: 1295-1306, 1993.

Xu Y, et al. Biosynthesis of the cyclooligomer depsipeptide bassianolide, an insecticidal virulence factor of Beauveria bassiana. Fungal Genet. Biol. 46: 353-364, 2009. PubMed: 19285149

Xu Y, et al. Biosynthesis of the cyclooligomer depsipeptide beauvericin, a virulence factor of the entomopathogenic fungus Beauveria bassiana. Chem. Biol. 15: 898-907, 2008. PubMed: 18804027

type strain of Sporotrichum sulfurescens

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation