Wallemia mellicola Jancic et al. (ATCC® 42694)

Strain Designations: FRR 1471  /  Product Format: freeze-dried

Deposited As Wallemia sebi (Fries) von Arx
Strain Designations FRR 1471
Application
Reference strain for performance testing culture media listed by the ISO TC 34 SC 9 Joint Working Group 5 in the ISO 11133 and by the Working Party on Culture Media of the International Committee on Food Microbiology and Hygiene (ICFMH-WPCM)
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Comments Xerophilic

The strain was recently re-identified as Wallemia mellicola, a close sister of Wallemia sebi, based on the multigene sequence analysis. This change does not affect to its use as quality control strain for standard tests.
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

GAGTGTAAAAACTCATAATCTTCTATACAAACCACTGTTTTAAAATGTTTACTAGAATGTCCAAGCAGTTAAGCTGTTGAAATATTAAAAGTTTNATAAAACTTTCAGCAACGGATCTCTTGGTTCAGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGATACAGTGAATCATCGAATCTTTGAACGCAAATGGCACTCTATGGTATTCCGTAGAGTACGTCTGTTTGAGCGTCGCGAACATCTCCATAATTAGTTTTTTTTAAATTGATTGTGGGTTTTGAGGTTGTCATATAAGCAATGACTCCCTTTAAAATAATTAGTGATGACCTTATGAATGGGTTAATACTGTGTGTTATAATGGATTACATCCATCACCAGTCAGAGAGTAATCTCGCCTTAGTAATTTGTAGTGATTGCTTCTAACTGCCATTGGCAAACAAACTGATCAAATCGACCTCAAATCAGATGGGATTACCCGCTGAACTTAAGCATATCAATAA


D1D2 region of the 28S ribosomal RNA gene

ATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGAGGGAAAAGCTCAAATTTAAAAGCTGTTGTCTTTCAGGCAACCGCATTGTAATCTCAAGAAGTGTTTTCGATTGTAGCCTGCGTATAAGTACCTTGGAATAGGTTGGCATAGAGGGTGAAACTCCCGTCTTTGATGCAGATTACTATGATCATGTGATACACTTTCTAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCCTGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGAACGTGAAATTGCTGAAAGGGAAGCGTTTGAAGTTAGTCTGATAGGAGTTGTTCAATTGTTACTTTGGTTTCAATGTATGCAACTTTTTATCGGTCAACATCAATTTTGATTGATGGATAAAGGTAATAGGAATGTGGCTACAATTTGTAGTGTTATAGCCTATTATCATAAACATTGATTGAGATTGAGGACGGCAGTGTACCTTTTAGGAAGGTGTTCGCACCTATTACACTAAGGATGTTGACAAAATAGCTTTAAGCGAC


RNA polymerase II largest subunit (RPB1) gene

TCCATATTGGTACGTGTGGTTGTGCGTAGGCACACTGTCAGCTGACTCCGTTCTCAGGTTTCTTGACGAAAATCAAAAAAATCATTGAAAGTATTTGTGTTAATTGTGGTAGATTATTGGCGGATGAAGTTTGTTTATCGTTATATCTACGCTTACAGACTAACGCATCTCCAGAATGACCCAGAACTCGCAAAGATAGTTCGCACCGTTCCAGTGGGAAAGAGGCGGTTTGAAGCTGTACACGCGTACTGTACGAAAATCAGTATTTGTAAACCGGACGAACCAAATGAGAATGGTGAGGATGCACCACCATCTCAACCAGGTCACGGTGGTTGTGGTCGTCTACAACCAGCTATCAGAAGGGAAGCATTGAAGTTGTTTTCTGTGAACAAACAACAAAAACATGATGAGGAGGCGAGTATTCAATGAAGCGCTTCTATCCCTTTCTAACAACCTGTAGGATGACACGAAAGCTCAGCAGGATAAGCGTCAGCTTTCAGCTGCAGAAGTTTACACGTTATTTAAAAAGATTCCGGATAGTGACATAACCCTGATGGGTCTTTCAGCTGAATTCGCTCGTCCAGATTGGATGATTATCACCGTTCTCCCAGTTCCTCCACCTCCAGTCCGTCCTTCAATTGCCGTCGACGGTGGTGCTACCCGCTCAGAAGATGATCTGACATATAAGCTCGCCGATATCCTTAAATACACTGCAACACTTCGTCGTTTCGAATCTGAAGGCGCTCCAGCGCACATTATTAGTGAAAATGAACAATTAGTTCAATTCCACGTAGCT

Name of Depositor AD Hocking
Chain of Custody
ATCC <-- AD Hocking <-- JI Pitt
Isolation
Bread, Australia
Cross References

Nucleotide (GenBank) : KU933448 ITS including 5.8S rRNA gene

Nucleotide (GenBank) : KU933425 D1/D2 region of 28S rRNA gene

Nucleotide (GenBank) : KU933453 RNA polymerase II largest subunit (RPB1) gene