Alternaria chartarum Preuss (ATCC® 26683)

Strain Designations: 503  /  Product Format: freeze-dried

Deposited As Alternaria humicola Oudemans
Strain Designations 503
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Comments
Habitat
Morphology

Colonies spreading rapidly, reaching 6-8 cm diam in seven days at 25ºC. Conidiophores brown, forming conidia solitary or in short chains Conidia obclavate or with a beak, pale golden brown, mostly smooth-walled but sometimes minutely verruculose, muriform with four to seven transverse septa, 22-95 x 8-19 µm.

Medium ATCC® Medium 340: Rabbit food agar
ATCC® Medium 335: Potato carrot agar
ATCC® Medium 336: Potato dextrose agar (PDA)
Growth Conditions
Temperature: 24°C to 26°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal   transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.

TTAGAAGAAATGTACCTCCCATTTAGAGCTGCATTCCCAAACAACTCGACTCGTCGAAGGGGCTTTACACGGCAATAGCCAGCGACCACGTACGGGATTCTCACCCTCTGTGACGTCCTGTTCCAAGGAACTTGGACCGCTGCCAAAGCCAAAGCGCCCTCTGCAAATTACAACTCGGACTCTAAAAGAGCCAGATTTCAAATTTGAGCTGTTGCCGCTTCACTCGCCGTTACTAGGGCAATCCCTGTTGGTTTCTTTTCCTCCGCTTATTGATATGCTTAAGTTCAGCGGGTATCCCTACCTGATCCGAGGTCAAAAGTTGAAAAAAAGGCTTAATGGATGCTAGACCTTTGCTGATAGAGAGTGCGACTTGTGCTGCGCTCCGAAACCAGTAGGCCGGCTGCCAATTACTTTAAGGCGAGTCTCCAGCAAAGCTAGAGACAAGACGCCCAACACCAAGCAAAGCTTGAGGGTACAAATGACGCTCGAACAGGCATGCCCTTTGGAATACCAAAGGGCGCAATGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACACTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCCAGAACCAAGAGATCCGTTGTTGAAAGTTGTAATTATTAATTTGTTACTGACGCTGATTGCAATTACAAAAGGTTTATGTTTGTCCTAGTGGTGGGCGAACCCACCAAGGAAACAAGAAGTACGCAAAAGACAAGGGTGAATAATTCAGCAAGGCTGTAACCCCGAGAGGTTCCAGCCCGCCTTCATATTTGTGTAATGATCCCTCCGCAGGTTCACCTACGGAGACCTTGTTACGACTTTTACT

Morphology

Colonies spreading rapidly, reaching 6-8 cm diam in seven days at 25ºC. Conidiophores brown, forming conidia solitary or in short chains Conidia obclavate or with a beak, pale golden brown, mostly smooth-walled but sometimes minutely verruculose, muriform with four to seven transverse septa, 22-95 x 8-19 µm.

Name of Depositor JW Phelps
Isolation
Sand, Wisconsin
References

Phelps JW. Microfungi in two Wisconsin sand blows. Trans. Br. Mycol. Soc. 61: 386-390, 1973.