Beauveria bassiana (Balsamo) Vuillemin (ATCC® 20872)

Strain Designations: 447  /  Product Format: freeze-dried

Permits and Restrictions

View Permits

Deposited As Beauveria bassiana (Balsamo) Vuillemin
Strain Designations 447
Application
biological control of pharaoh ants, Monomorium pharaonis
biological control of American cockroaches, Periplaneta americana
biological control of carpenter ants, Camponotus spp.
biological control of German cockroaches, Blatella germanica
biological control of imported fire ants, Solenopsis spp.
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Disclosure This material is cited in a US or other Patent and may not be used to infringe the claims. Depending on the wishes of the Depositor, ATCC may be required to inform the Patent Depositor of the party to which the material was furnished. This material may not have been produced or characterized by ATCC.
Preceptrol® no
Comments Effect of soil on dose-response
Medium ATCC® Medium 200: YM agar or YM broth
ATCC® Medium 335: Potato carrot agar
ATCC® Medium 336: Potato dextrose agar (PDA)
Growth Conditions
Temperature: 24°C to 26°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

GTCGTAACAAGGTCTCCGTTGGTGAACCAGCGGAGGGATCATTACCGAGTTTTCAACTCCCTAACCCTTCTGTGAACCTACCTATCGTTGCTTCGGCGGACTCGCCCCAGCCCGGACGCGGACTGGACCAGCGGCCCGCCGGGGACCTCAAACTCTTGTATTCCAGCATCTTCTGAATACGCCGCAAGGCAAAACAAATGAATCAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCGACCTCCCCTGGGGGAGGTCGGCGTTGGGGACCGGCAGCACACCGCCGGCCCTGAAATGGAGTGGCGGCCCGTCCGCGGCGACCTCTGCGTAGTAATACAGCTCGCACCGGAACCCCGACGCGGCCACGCCGTAAAACACCCAACTTCTGAACGTTGACCTCGAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAA


D1D2 region of the 28S ribosomal RNA gene

ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTCAGGGCCCGAGTTGTAATTTGTAGAGGATGCTTTTGGCGAGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTATGGTCGGACACCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTATATGTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTTATGACCAGACTTGCGCCCGGTGAATCACCCAGCGTTCTCGCTGGTGCACTTTGCCGGGCACAGGCCAGCATCAGTTCAGCGCGGGGGAGAAAGGCTTCGGGAATGTGGCTCCCCCGGGAGTGTTATAGCCCGCTGCGTAATGCCCTGCGCCGGACTGAGGTACGCGCATTGCAAGGATGCTGGCGTAATGGTCATCAGCGAC


RNA polymerase II largest subunit gene (RPB1)

CCATATAGAGCTGGCGAAACCTGTCTATCACCCTGGTTTCATCAAGAAAGTGAAAAAGGTTTTGGAGATTGTCTGCCACAACTGCAGCAAAGTGTTGGCCGATGAAGTTGGTCTTCCCTTTACTCCATGAAGCTTTGGAGCTTGCTGGATGCTAACGTGCATTATCAGAGCGATCCCGAATTCGTCACAGCTATTCATACTCGCGATCCGAAACTCCGATTCAAGCGCGTTTGGGCCGTATGCAAGAAGAAGCGCAAATGCGAGAATGAGGAGCGGCAAGACAAGAATAAAGACGAAGAGTTCGCTCCAGGTGTCAAGAACGTCGTTCTCGAAGGACATGGCGGATGTGGCAATATGCAGCCGCAGGTGAGACAGGCCGCGCTGCAACTCAAAGCTGCCTTCGAGGTTACTTCGGAAGAGGGTCCCAAGAGGAAAGAGACGGTTAATATCAGCGCCGAGATGGCGCATGGTATCCTTCGCCGCATCTCTGAGCGCGATCTGCACAATATTGGTCTTAACTCAGACTATGCTCGTCCCGAGTGGATGATCATCACTGTCCTGCCTGTACCCCCTCCTCCCGTGCGTCCTAGTATTTCCATGGATGGTACTGGTACTGGCACGAGAAACGAGGATGATCTGACCTACAAGCTTGGTGACATCATCCGCGCCAACGGTAATGTCAAGCAGGCCATTCGTGAAGGATCACCGCAACACATCGCGCGTGATTTTGAGGAGCTGCTGCAGTACCATGTTGCC

Name of Depositor University of Florida, Gainesville
U.S. Patent Number
Disclosure This material is cited in a US or other Patent and may not be used to infringe the claims. Depending on the wishes of the Depositor, ATCC may be required to inform the Patent Depositor of the party to which the material was furnished. This material may not have been produced or characterized by ATCC.
Isolation
Adult worker fire ants, Solenopsis invicta, Mato Grosso, Brazil
Cross References

Nucleotide (GenBank) : KU729042 ITS including 5.8S rRNA gene

Nucleotide (GenBank) : KU729127 D1/D2 region of 28S rRNA gene

Nucleotide (GenBank) : KU933455 RNA polymerase II largest subunit (RPB1) gene

References

Stimac JL. Biological control of imported fire ants with a fungal pathogen. US Patent 4,925,663 dated May 15 1990

Wright JE, Chandler LD. Biopesticide composition and process for controlling insect pests. US Patent 5,413,784 dated May 9 1995

Pereira RM, et al. Soil antagonism the dose-response of workers of the red imported fire ant, Solenopsis invicta, to Beauveria bassiana conidia. J. Invertebr. Pathol. 61: 156-161, 1993.

Stimac JL, Pereira R. Controlling cockroaches, carpenter ants, and pharaoh ants using strains of Beauveria bassiana. US Patent 5,683,689 dated Nov 4 1997

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation