Ogataea polymorpha (Morais et Maia) Yamada, Maeda et Mikata, teleomorph (ATCC® 14754)

Strain Designations: NRRL Y-1798 [ATCC 24609, CBS 1976, CCRC 22167, IFO 0799, JCM 3620, NCYC 495, VKM Y-1397, VKPM Y-123]  /  Product Format: freeze-dried

Permits and Restrictions

View Permits

Deposited As Hansenula angusta Wickerham, teleomorph
Strain Designations NRRL Y-1798 [ATCC 24609, CBS 1976, CCRC 22167, IFO 0799, JCM 3620, NCYC 495, VKM Y-1397, VKPM Y-123]
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format freeze-dried
Type Strain yes (type strain of Hansenula angusta)
Preceptrol® no
Morphology

After 3 days at 25°C an YM medium cells are spheroidal to elongate, (1.5-4.6) x (1.9-5.3) um, single in pairs, or in small clusters.  Growth is butyrous and tannish-white in color.

Medium ATCC® Medium 200: YM agar or YM broth
Growth Conditions
Temperature: 24.0°C
Sequenced Data
GenBank accession number: FJ914920

18S ribosomal RNA gene, partial sequence; internal   transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.

GTTTCCGTAGGTGAACCTGCGGAAGGATCATTACAGTATTCTTCTAAGCTGGAGCTGCTGATCGACTGAACTGTTTGCCTGCGCTGCTGAAATATTGCGTGCGCGGCGATGGTTTTTTTGGTTGCAGTTCTACTCAAGGCTTAGAAATCTCCTTACACACTTTGTTTTCTTATTAGAGACAAATTTGCTTTGGCTAGCGGTCGCTTAAGCGCGGCATGGCTGGCCAGAGGTTTTAACAAAACTCATTTTCGTCTTGCCCATGTGGGGAAGACTGAAAACTTGTATTATGATTTTGTCAGTTATAAGAAGTTGCGTTTGCAGCTTTTCTAAACTTCAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGATTTTCGTGAATCATTGAATCTTTGAACGCACATTGCGCCCTCTGGTATTCCAGAGGGCATGCCTGTTTGAGCGTCATTTCCCTCTCAAACCCTCGGGTTTGGTGATGGGCAATACTCTCTTTTCTGAGAGTTTGCTTGAAATGAATTGGCATGAGTTTTTGATACGAACTTCAGCTGTTTATTCAATGTATTAGGTTTTATCCATCGTTGATTGACAACTGCAAGCTTCTTTCAAAAATTGGCTCTGCCTTACAAACTTTAATCATAAAGTTTGACCTCAAATCAGGTAGGATTACCCGCTGAACTTAAGCAT

GenBank accession number: FJ914937

         Large subunit ribosomal RNA gene, partial sequence.

CATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTTAGTAGCGGCGAGTGAAGCGGCAAGAGCTCAAATTTGAAATCTGGTACCTTCGGTGCCCGAGTTGTAATTTGAAGAAAGCTATCTTGGAGGTGGCCCTTGTCTATGTTCCTTGGAACAGGACGTCATGGAGGGTGAGAATCCCGTGTGATGAGGTGTCCATTTCCGTGTAAGATGCTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACTGTGAAGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGTATTTGATCAGACTTGGTATTTAGCTATCATCGCTCCTTGTGGGTGGTGCTCTAGCTTTTTACTGGGCCAGCATCAGTTTTGGTGGCAAGATAATGACAGTTGAATGTGGCTCCTCGGAGTGTTATAGCTTCTGTTGATGTTGCCTACCGAGACTGAGGTCTGCGGCTTTTGCCTAGGATGCTGGCGTAATGATCCAATACCGC

Morphology

After 3 days at 25°C an YM medium cells are spheroidal to elongate, (1.5-4.6) x (1.9-5.3) um, single in pairs, or in small clusters.  Growth is butyrous and tannish-white in color.

Name of Depositor NRRL
Isolation
spoiled orange juice, Florida
Cross References

Nucleotide (GenBank) : FJ914937 D1/D2 region of 28S rRNA gene

Nucleotide (GenBank) : FJ914920 ITS including 5.8S rRNA gene

References

Wickerham LJ. Taxonomy of yeasts. U.S. Dep. Agric. Tech. Bull. 1029: 1951..

Titorenko VI, et al. Identification and characterization of cytosolic Hansenula polymorpha proteins belonging to the Hsp70 protein family. Yeast 12: 849-857, 1996. PubMed: 8840502

Baerends RJ, et al. Deviant Pex3p levels affect normal peroxisome formation in Hansenula polymorpha: high steady-state levels of the protein fully abolish matrix protein import. Yeast 13: 1437-1448, 1997. PubMed: 9434349

Suh SO, Zhou JJ. Methylotrophic yeasts near Ogataea (Hansenula) polymorpha: a proposal of Ogataea angusta comb. nov. and Candida parapolymorpha sp.nov. FEMS Yeast Res. 10: 631-638, 2010. PubMed: 20491937

type strain of Hansenula angusta

type strain of Hansenula angusta

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation