Isaria fumosorosea Wize (ATCC® MYA-4887)

Strain Designations: ARSEF 2679  /  Product Format: frozen

Strain Designations ARSEF 2679
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Genome Sequenced Strain

Yes

Comments
Insect pathogenic fungi
Genome sequencing strain (Shanghai Institutes for Biological Sciences, CAC, China)
Morphology On YM medium at 25°C after 13 days, mycelium white to dingy white, dense, slightly raised forming a mound, velvety. Conidia ellipsoidal to broadly fusiform, smooth, 4-5 µm X 2-3 µm.
Medium ATCC® Medium 200: YM agar or YM broth
ATCC® Medium 334: Oatmeal agar
ATCC® Medium 336: Potato dextrose agar (PDA)
Growth Conditions
Temperature: 24°C to 26°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal   transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

TCCGTTGGTGAACCAGCGGAGGGATCATTACCAGAGTTTTCACAACTCCCAACCCTCCTGTGAACCTACCCATCGTTGCTTCGGCGGACTCGCCCCAGCGTCCGGACGGCCTCGCGCCGGCCCGCGACCTGGACCCAGGCGGCCGCCGGAGACCACGCAACCCTGCATCCATCAGTCTCTCTGAATCCGCCGCAAGGCAACACAAACGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCGACGTCCCCCGGGACGTCGGCCTTGGGGACCGGCAGCACCCCGCCGGCCCTGAAATGGAGTGGCGGCCCGTCCGCGGCGACCTCTGCGAAGTACTACAGCTCGCACCGGAAACCCGACGCGGCCCCGCCGTGAAACCCCCAACTCTGAACGTTGACCTCGGATCAGGTAGGA-CTACCCGCTGAACTTAAG

 

D1D2 region of the 28S ribosomal RNA gene

ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCCCGGGTCCGAGTTGTAATTTGCAGAGGATGCTTCGGGCGAGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTCTGGTCGGACACCGAGCCCGTGTGAAGCTCCTTCGAAGAGTCGAGTAGTTTGGGAATGCTGCTCAAAACGGGAGGTATATGTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCCCATGACCAGACTTGGGCCCGGTGAATCACCCGGCGTTCTCGCCGGTGCACTTTGCCGGGCACAGGCCAGCATCAGTTTGGCGCGGGGGAGAAAGGCTTCGGGAACGTGGCTCCCTCGGGAGTGTTATAGCCCGCTGCGCAATACCCTGCGCCGGACTGAGGTACGCGCATCGCAAGGATGCTGGCGTAATGGTCATCAGCGA

Morphology On YM medium at 25°C after 13 days, mycelium white to dingy white, dense, slightly raised forming a mound, velvety. Conidia ellipsoidal to broadly fusiform, smooth, 4-5 µm X 2-3 µm.
Name of Depositor RA Humber
Special Collection ATCC
Chain of Custody
ATCC <-- RA Humber <--AS Martins
Isolation
Popillia japonica (Coleoptera: Scarabaeidae), Terceira Island, Azores, Portugal.
Cross References

Nucleotide (GenBank) : JQ906773 ITS including 5.8S rRNA gene

Nucleotide (GenBank) : JQ906768 D1/D2 region of 28S rRNA gene

Nucleotide (GenBank) : AZHE00000000 Metarhizium album ARSEF 1941, whole genome shotgun sequencing project

References

Hu X, et al. Trajectory and genomic determinants of fungal-pathogen speciation and host adaptation. Proc Natl Acad Sci USA 111: 16796-16801, 2014. PubMed: 25368161