Advanced Search

Candida albicans (Robin) Berkhout (ATCC® MYA-4782™)

Strain Designations: A92  /  Product Format: frozen

Permits and Restrictions

View Permits

Strain Designations A92
Application
Opportunistic pathogen research
Sexually Transmitted Disease Research
Biosafety Level 2

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.
Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Genome Sequenced Strain

Yes

Comments
Clinical isolate
Genome sequencing strain (Broad Institute, USA)
Morphology After 5 days at 25°C on both YM and YEPD medium, colonies white to creamy white, butyrous, smooth, raised, margin begins entire (3 days) and becomes filamentous over time (11 days). Cells globose to subglobose, smooth, large cells 6-6.755 µm x 4.5-6 µm, small cells 3.75-4.5 µm x 3-3.75 µm. Pseudohyphae abundant on YM medium and not observed on YEPD medium.
Medium ATCC® Medium 200: YM agar or YM broth
ATCC® Medium 1245: YEPD
Growth Conditions Temperature: 30°C to 37°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.

GTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACTGATTTGCTTAATTGCACCACATGTGTTTTTCTTTGAAACAAACTTGCTTTGGCGGTGGGCCCAGCCTGCCGCCAGAGGTCTAAACTTACAACCAATTTTTTATCAACTTGTCACACCAGATTATTACTAATAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATATGAATTGCAGATATTCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGAGGGCATGCCTGTTTGAGCGTCGTTTCTCCCTCAAACCGCTGGGTTTGGTGTTGAGCAATACGACTTGGGTTTGCTTGAAAGACGGTAGTGGTAAGGCGGGATCGCTTTGACAATGGCTTAGGTCTAACCAAAAACATTGCTTGCGGCGGTAACGTCCACCACGTATATCTTCAAACTTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATA


D1D2 region of the 28S ribosomal RNA gene:

TTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAGCGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCGTCTTTGGCGTCCGAGTTGTAATTTGAAGAAGGTATCTTTGGGCCCGGCTCTTGTCTATGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTGCGATGAGATGACCCGGGTCTGTGTAAAGTTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGTATTTTGCATGCTGCTCTCTCGGGGGCGGCCGCTGCGGTTTACCGGGCCAGCATCGGTTTGGAGCGGCAGGATAATGGCGGAGGAATGTGGCACGGCTTCTGCTGTGTGTTATAGCCTCTGACGATACTGCCAGCCTAGACCGAGGACTGCGGTTTTTACCTAGGATGTTGGCATAATGATCTTAAGTCGCCCGTCTTG
Morphology After 5 days at 25°C on both YM and YEPD medium, colonies white to creamy white, butyrous, smooth, raised, margin begins entire (3 days) and becomes filamentous over time (11 days). Cells globose to subglobose, smooth, large cells 6-6.755 µm x 4.5-6 µm, small cells 3.75-4.5 µm x 3-3.75 µm. Pseudohyphae abundant on YM medium and not observed on YEPD medium.
Name of Depositor M Noverr
Special Collection ATCC
Chain of Custody
ATCC <-- M Noverr <-- C Fichtenbaum
Isolation
HIV patient with mucosal candidiasis, in St. Louis, MO, USA
Cross References

Nucleotide (GenBank) : JN874495 D1/D2 region of 28S rRNA gene

Nucleotide (GenBank) : JN882316 ITS including 5.8S rRNA gene

References

Taylor BN, et al. In vivo virulence of Candida albicans isolates causing mucosal infections in people infected with the Human Immunodeficiency Virus. J. Infect. Dis. 182: 955-999, 2000.

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation
Product Sheet
Product Sheet
Certificate of Analysis
Certificate of Analysis
SDS
SDS