Phanerochaete chrysosporium Burdsall, teleomorph (ATCC® MYA-4764)

Alternate State: Sporotrichum pulverulentum Novobranova, anamorph, Sporotrichum pruinosum Gilman et Abbott, anamorph  /  Strain Designations: RP-78 [FGSC 9002]  /  Product Format: frozen

Permits and Restrictions

View Permits

Strain Designations RP-78 [FGSC 9002]
Alternate State Sporotrichum pulverulentum Novobranova, anamorph, Sporotrichum pruinosum Gilman et Abbott, anamorph
Application
degrades lignin
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Genome Sequenced Strain

Yes

Comments
White rot fungus
Genome sequencing strain (the Joint Genome Institute at the Department of Energy, USA)
Morphology On potato dextrose medium at 25°C after 5 days, colonies white, mycelium appressed to agar surface, felt like texture becoming loosely cottony with age. Chlamydospores abundant, spherical to oblong, terminal, 28.5-39 µm X 25.5-34.5 µm.
Medium ATCC® Medium 200: YM agar or YM broth
ATCC® Medium 324: Malt extract agar
ATCC® Medium 336: Potato dextrose agar (PDA)
Growth Conditions
Temperature: 20°C to 25°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal   transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.

GTAGGTGAACCTGCGGAAGGATCATTAACGAGTAACTGAACAGGTTGTAGCTGGCCTCTCGGGGCATGTGCACGCCTGGCTCATCCACTCTTCAACCTCTGTGCACTTGTTGTAGGTCGGTAGAAGAGCGAGCATCCTCTGATGCTTTGCTTGGAAGCCTTCCTATGTTTTACTACAAACGCTTCAGTTTAAGAATGTCTACCTGCGTACAACGCATCTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCCTGGTATTCCGGGGAGCATGCCTGTTTGAGTGTCATGGTATCCTCAACCTTCATAACTTTTTGTTATCGAAGGCTTGGACTTGGAGGTTGTGCTGGCTTCTAGTCGAGTCGGCTCCTCTTAAATGTATTAGCGTGAGTGTAACGGATCGCTTCGGTGTGATAATTATCTGCGCCGTGGTCGTGAAGTAACATAAGCTTGCGCTTCTAACCGTCCTTCAGTTGGACAACTTACTTTGACATCTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCAT


D1D2 region of the 28S ribosomal RNA gene.

AACTTAAGCATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCAGTCTTTGGCTGTCCGAGTTGTAATCTGGAGAAGCGTCTTCCGCGCTGGACCGTGTACAAGTCTCCTGGAACGGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCTCTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAACTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTTTGCTAGGACTCAGCCTGGTTTCGGCCTGGTGCACTTCCTAGTAAACGGGCCAGCATCACTTTTGGCTGCGGGAAAAAGGTTAGAGGAATGTGGCACCCTCGGGTGTGTTATAGCCTCTAGCTGTATACCGTGGCTGGGAGTGAGGAACTCAGCACGCCTTCTGGCGGGGCTTCGGCCACCTTCGTGCTTAGGATGCTGGCGTAATGGCTTTAAACGACCCGTCTTG

Morphology On potato dextrose medium at 25°C after 5 days, colonies white, mycelium appressed to agar surface, felt like texture becoming loosely cottony with age. Chlamydospores abundant, spherical to oblong, terminal, 28.5-39 µm X 25.5-34.5 µm.
Name of Depositor FGSC
Special Collection ATCC
Chain of Custody
ATCC <-- FGSC
Isolation
Homokaryotic strain derived from BKM-F-1767 (ATCC® 24725™)
Cross References

Nucleotide (GenBank) : JN874484 D1/D2 region of 28S rRNA gene

Nucleotide (GenBank) : JN882305 ITS including 5.8S rRNA gene

Nucleotide (GenBank) : AADS00000000 Phanerochaete chrysosporium RP-78, whole genome shotgun sequencing project

References

Stewart P, Gaskell J, Cullen D. A homokaryotic derivative of a Phanerochaete chrysosporium strain and its use in genomic analysis of repetitive elements. Appl Environ Microbiol. 66: 1629-1633, 2000.

Martinez D, et al. Genome sequence of the lignocellulose degrading fungus Phanerochaete chrysosporium strain RP78. Nat. Biotechnol. 22: 695-700, 2004.

Fernandez-Fueyo E, et al. Comparative genomics of Ceriporiopsis subvermispora and Phanerochaete chrysosporium provide insight into selective ligninolysis. Proc. Natl. Acad. Sci. USA, in press (doi: 10.1073/pnas.1119912109).

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation