Terfezia boudieri Chatin (ATCC® MYA-4762)

Strain Designations: S1  /  Product Format: frozen

Strain Designations S1
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format frozen
Type Strain no
Preceptrol® no
Genome Sequenced Strain

Yes

Comments
desert truffle
genome sequencing strain (the Joint Genome Institute at the Department of Energy, USA)
Morphology

On MD-336 at 25C after 26 days, colonies white,

cottony, aerial hyphae abundant, margin filamentous.

Hyphae guttulate, hyphal swellings present, clamps not

observed.

Medium ATCC® Medium 336: Potato dextrose agar (PDA)
Growth Conditions
Temperature: 20.0-25.0°C
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal   transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.

GTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACTGAAAAACTATTTTAAGTTTTTTATATCCCATTGTTTACTTACCCTGTTGCTTTCACTGGACAGATTTCACCTTGTGTGGGTCCTTTGGCTTGTGTGAAATACCACTTGCCAAAGAGTTGCCAGTGGTAAGACCTATTTATCAAAACTTGAGTTTCAATAAACACAACTGTCTGAATATTTTTTTTCTTTAATGAAATAAAACTTTCAACAACGGATCTCTAGGCTCTTGCATCGATGAAGAACGCAGTGAAATGCGATAAGTAATGTGAATTGCAGAATCTCGTGAATCATTGAATCTTTGAACGCACATTGCGCCCTATGGTATTCCATTGGGCATGCCTGTCTGAGCGTCAGCTCCCCCTCCACTCAAGAATTATTTTATATGATACTTGGATTACTTTGGAGATGTAACTGTATATTAAGTTGCCCTCCAGAAATTCATTGGCAGTATGGTTTGTACTTGGACCAGACGTAATAGTAATAAAATCGTTTGTTTGGGTATAATTGAATTGTACTTGCCTTAACCCCCACCCATTTTTATTTTGGGTGACCTCAGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAAT

Morphology

On MD-336 at 25C after 26 days, colonies white,

cottony, aerial hyphae abundant, margin filamentous.

Hyphae guttulate, hyphal swellings present, clamps not

observed.

Name of Depositor Y Sitrit
Special Collection ATCC
Chain of Custody
ATCC <-- Y Sitrit
Isolation
Monosporic culture from fruiting body, Negev desert, Israel.
Cross References

Nucleotide (GenBank) : JN882304 ITS including 5.8S rRNA gene