Agaricus bisporus (Lange) Imbach var. bisporus, teleomorph (ATCC® MYA-4626)

Strain Designations: FGSC 10389 [H97]  /  Product Format: frozen

Strain Designations FGSC 10389 [H97]
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format frozen
Type Strain no
Preceptrol® no
Genome Sequenced Strain

Yes

Mating Type A1
Comments
Genome sequencing strain (the Joint Genome Institute at the Department of Energy, USA).
Medium ATCC® Medium 336: Potato dextrose agar (PDA)
ATCC® Medium 324: Malt extract agar
Growth Conditions
Temperature: 20.0-25.0°C
Sequenced Data
>ITS of MYA-4626

GGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATTGAATTATGTTTTCTAGATGGGTTGTAGCTGGCTCTTCGGAGTATGTGCACGCCTGTCTGGACTTCATTTTCATCCACCTGTGCACCTTTTGTAGTCTTTTTCAGGTATTGGAGGAAGTGGTCAGCCTATCAGCTCTTTGCTGGATGTAAGGACTTGCAGTGTGAAAACAGTGCTGTCCTTTACCTTGGCCATGGAATCTTTTTCCTGTTAGAGTCTATGTTATTCATTATACTCTTAGAATGTCATTGAATGTCTTTACATGGGCTATGCCTATGAAAATTATTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCATCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTATATTCTCAACTCTCCAATACTTTGTTGTAAAGGAGAGCTTGGATTGTGGAGGTTTGCTGGCTCCTTACTTGGGGTCAGCTCCTCTGAAATGCATTAGCGGAATCGTCTGCGATCTGCCACAAGTGTGATAACTTATCTACACTGGCGAGGGGATTGCTTTCTGATGTTCAGCTTCTAATCGTCTAAGGACAATTTCTTGAATGCTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAA

//

Name of Depositor FGSC
Special Collection ATCC
Chain of Custody
ATCC <-- FGSC
Cross References

Nucleotide (GenBank) : GU327642 ITS including 5.8S rRNA gene