Fusarium oxysporum f. sp. lycopersici (Saccardo) Snyder et Hansen, anamorph (ATCC® MYA-4623)

Strain Designations: FGSC 9935 [NRRL 34936, 4287]  /  Product Format: frozen

Strain Designations FGSC 9935 [NRRL 34936, 4287]
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Genome Sequenced Strain

Yes

Comments
Genome sequencing strain (Broad Institute, USA; University of Amsterdam, The Netherlands)
Plant pathogen
Medium ATCC® Medium 336: Potato dextrose agar (PDA)
ATCC® Medium 324: Malt extract agar
Growth Conditions
Temperature: 24°C to 26°C
Atmosphere: Typical aerobic
Sequenced Data
ITS of MYA-4623

GTCTCCGTTGGTGAACCAGCGGAGGGATCATTACCGAGTTTACAACTCCCAAACCCCTGTGAACATACCACTTGTTGCCTCGGCGGATCAGCCCGCTCCCGGTAAAACGGGACGGCCCGCCAGAGGACCCCTAAACTCTGTTTCTATATGTAACTTCTGAGTAAAACCATAAATAAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCAAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCTGCCAGTATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCACAGCTTGGTGTTGGGACTCGCGTTAATTCGCGTTCCCCAAATTGATTGGCGGTCACGTCGAGCTTCCATAGCGTAGTAGTAAAACCCTCGTTACTGGTAATCGTCGCGGCCACGCCGTTAAACCCCAACTTCTGAATGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAA

Name of Depositor FGSC
Special Collection ATCC
Chain of Custody
ATCC <-- FGSC
Cross References

Nucleotide (GenBank) : GU327639 ITS including 5.8S rRNA gene

References

Wang H, et al. A fungal phylogeny based on 82 complete genomes using the composition vector method. BMC Evol. Biol. 9: 195, 2009. PubMed: 19664262

Ma LJ, et al. Comparative genomics reveals mobile pathogenicity chromosomes in Fusarium. Nature 464: 367-373, 2010. PubMed: 20237561