Malassezia restricta E. Guého, J. Guillot et Midgley (ATCC® MYA-4611)

Strain Designations: CBS 7877 [ATCC 96810, JCM 14890, RA 42.2C, NBRC 103918]  /  Product Format: frozen

Permits and Restrictions

View Permits

Strain Designations CBS 7877 [ATCC 96810, JCM 14890, RA 42.2C, NBRC 103918]
Biosafety Level 2

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain yes
Preceptrol® no
Genome Sequenced Strain

Yes

Comments Lipophilic or lipid-dependent yeasts.
Genome sequencing strain (The Procter & Gamble Company, USA; Genome Institute of Singapore, Singapore).
Opportunistic pathogen that can cause systematic infection in neonates and are associated with multiple human skin disorders.
Medium ATCC® Medium 2693: modified Dixon (mDixon)
ATCC® Medium 2737: Modified Leeming & Notman Agar (MLNA)
Growth Conditions
Temperature: 30°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

GGTTTCTGTAGGTGAACCTGCAGAAGGATCATTAGTGAAGATTTGGGCAGGCCATACGGACGCCAAAAAGTGTCCCTGGCCGCCTACACCCACTATACATCCACAAACCCGTGTGCACTGTCTTGGAGAAAGGCTTCAGAGAAGTTTTTTGTGGCCTCTCTTGGGGTCTTTCTTCGCTACAAACTCGAATGGTTAGTATGAACGTGGAACTTGGTTGGACCGTCACTGGCCAACAAACTATACACAACTTTCGACAACGGATCTCTTGGTTCTCCCATCGATGAAGAACGCAGCGAAACGCGATAGGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCTATGGCAATCCGTAGAGCATGCCTGTTTGAGTGCCATGAAATCTCCCACCCCAAGCGGTTTTTACATGAAACGGCTTGGCGGATGGGGTCTGGATGGGTGCCTCTGCCTGCGCTACCTAGCACAGGCTCGCCCGAAATGCATGAGCGCCTTGAGACACTTTGCATCCGCCTCTCTGTTTGGGAGGAGGCGGCCAAGCAGTGTTTTTCTCCTGGCATGGCATGATACGTCATTTGCTATGTCGCCTAAAGGAGGAATGTTTGGTTGTGTCTGCGTGTGCTTCGAACTTGCCTCTGTGGCACATCCCAATTTCACTTCTGGTCTCAAATCAGGTAGGATCACCCGCTGAACTTAAGCATATCAATAA


D1D2 region of the 26S ribosomal RNA gene

ATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACGGCGAGCGAAGCGGGAAGAGCTCAAATTTGAAAGCTGGCGTCTTCGGCGTCCGCGTTGTAATCTCGAGACGTGTTTTCCGTGCGGCTCTATGGACAAGTCCCTTGGAACAGGGCATCGTAGAGGGTGAAAATCCCGTACTTGCCATGGAAGTACCGTGCTTTGTGATACACGCTCCAAGAGTCGAGTAGTTTGGGATTGCTGCTCAAAGTGGGTGGTAGACTCCATCTAAAGCTAAATATCGGGGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAGTACGTGAAATTGTCGAAAGGGAAGCACTTGAAGTCAGCCATGCTGCTTGAGACTCAGCCTGGCTTTTGCTTGGTGTATTTCTCGGTAGCAAGCCAGCATTGGTTTGTGTCGTCGGAGAAGCGTATGGGGAATGTGGCATCCTCGGATGTGTTATAGCCCTGTGCAGGATACGACGACGTAGACCAAGGAACGCAGTGTGCCCTCTGGGCGGGTCTTCGGACACCTTCACACTTAGGATGCTGGCGTAATGGCTTTAAGTGGC

Name of Depositor CBS
Special Collection ATCC
Chain of Custody
ATCC <-- CBS
Isolation
Skin of man, Bristol State, UK.
Cross References

Nucleotide (GenBank) : GU291286 D1/D2 region of 28S rRNA gene

Nucleotide (GenBank) : GU291270 ITS including 5.8S rRNA gene

Nucleotide (GenBank) : AAXK00000000 Malassezia restricta CBS 7877, whole genome shotgun sequencing project

Nucleotide (GenBank) : LFDA00000000 Malassezia restricta strain CBS 7877, whole genome shotgun sequencing project

References

Gueho E, Midgley G, Guillot J. The genus Malassezia with description of four new species. Antonie van Leeuwenhoek 69: 337-355, 1996. PubMed: 8836432

Xu J, et al. Dandruff-associated Malassezia genomes reveal convergent and divergent virulence traits shared with plant and human fungal pathogens. Proc Natl Acad Sci USA 104: 18730-18735, 2007. PubMed: 18000048

Castellá G, Coutinho SD, Cabañes FJ. Phylogenetic relationships of Malassezia species based on multilocus sequence analysis. Med. Mycol. 52: 99-105, 2014. PubMed: 23902157

Cabañes FJ, et al. Two New lipid-dependent Malassezia species from domestic animals. FEMS Yeast Res. 7(6): 1064-1076, 2007. PubMed: 17367513

Cabanes FJ, Hernandez JJ, Castella G. Molecular analysis of Malassezia sympodialis-related strains from domestic animals. J Clin Microbiol 43: 277-283, 2005. PubMed: 15634983

Gupta AK, et al. Identification and typing of Malassezia species by amplified fragment length polymorphism and sequence analyses of the internal transcribed spacer and large-subunit regions of ribosomal DNA. J Clin Microbiol 42: 4253-4260, 2004. PubMed: 15365020

Sugita T, et al. Genotype analysis of Malassezia restricta as the major cutaneous flora in patients with atopic dermatitis and healthy subjects. Microbiol Immunol 48: 755-759, 2004. PubMed: 15502408

Yamada Y, et al. DNA base alignment and taxonomic study of genus Malassezia based upon partial sequences of mitochondrial large subunit ribosomal RNA gene. Microbiol. Immunol. 47: 475-478, 2003. PubMed: 12906109

Gaitanis G, et al. Identification of Malassezia species from patient skin scales by PCR-RFLP. Clin. Microbiol. Infect. 8: 162-173, 2002. PubMed: 12010171

Makimura K, et al. Species identification and strain typing of Malassezia species stock strains and clinical isolates based on the DNA sequences of nuclear ribosomal internal transcribed spacer 1 regions. J Med Microbiol 49: 29-35, 2000. PubMed: 10628823

Fell JW, et al. Biodiversity and systematics of basidiomycetous yeasts as determined by large-subunit rDNA D1/D2 domain sequence analysis. Int. J. Syst. Evol. Microbiol. 50: 1351-1371, 2000. PubMed: 10843082

Kano R, et al. Chitin synthase 2 gene sequence of Malassezia species. Microbiol. Immunol. 43: 813-815, 1999. PubMed: 10524801

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation