Trichophyton equinum (Matruchot et Dassonville) Gedoelst (ATCC® MYA-4606)

Strain Designations: CBS 127.97  /  Product Format: frozen

Permits and Restrictions

View Permits

Deposited As Trichophyton tonsurans Malmsten
Strain Designations CBS 127.97
Biosafety Level 2

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Genome Sequenced Strain

Yes

Comments
Genome sequencing strain (Broad Institute, USA).
This strain was re-identified by the multigene sequence analysis.
Medium ATCC® Medium 323: Malt agar medium
ATCC® Medium 324: Malt extract agar
ATCC® Medium 336: Potato dextrose agar (PDA)
Growth Conditions
Temperature: 24°C to 26°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

GGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAACGCGCAGGCCGGAGGCTGGCCCCCCAGGATAGGGCCAAACGTCCGTCAGGGGTGAGCAGATGTGCGCCGGCCGTACCGCCCCATTCTTGTCTACCTTACTCGGTTGCCTCGGCGGGCCGCGCTCTCCCAGGAGAGCCGTTCGGCGAGCCTCTCTTTATAGCGGCTCAACGCTGGACCGCGCCCGCCGGAGGACAGACGCAAAAAAAAATTCTTTCAGAAGAGCTGTCAGTCTGAGCGTTAGCAAGCAAAAATCAGTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGCATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCAGCCCCTCAAGCCCGGCTTGTGTGATGGACGACCGTCCGGCGCCCCCGTCTCTGGGGGTGCGGGACGCGCCCGAAAAGCAGTGGCCAGGCCGCGATTCCGGCTTTCTAGGCGAATGGGCAACAAACCAGCGCCTCCAGGACCGGCCGCCCTGGCCTCAAAATCTGTTTTATACTTATCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAA


D1D2 region of the 28S ribosomal RNA gene

ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAAGAGCTCAAATTTGAAATCTGGCCTCCCCCGGGGGCCCGAGTTGTAATTTGCAGAGGATGTTTCGGGTGCGGCCGCCGTCTAAGTTCCTTGGAACAGGACGTCAGAGAGGGTGAGAATCCCGTCTTGGGCGGGCGGTCCGCGCCCGTGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGCGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGGTTAAAAGCACCTTGAAAAGGGAGTTAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCGGCCAGACTCGGGGGCGGGGTTCAGCGGGTGCTCGTCGCCCGTGTATTCCTCGTTTCCCGGGCCAGCATCAGTTTCGACGGCCGGTCAAAGGCCCCCGGAATGTGTCGTCTCTCGGGACGTCTTATAGCCGGGGGTGCAATGCGGCCCGTCGGGACTGAGGAACGCGCTCCGGCTCGGATGCTGGCGTAATGGCCGTAAGCGGC


beta-tubulin gene

CTAGCTTTCCCCCTGTCCATCACTTCCCCTCTATTTGTGCCCGAAAAACACGACACGGTCTGCACAGGCCAAGAAAGGGGGGGAGGCGAGGGCCACCACACGACCACGTCCCAGCGTGAAGGGGACAGGCTTCGAGTTTCACAATTCTCGCATAACGAGCTTCGAGCATCAGGCTAACGTGCATTTATCGTATAGGTCCATCTCCAAACCGGCCAATGTGTAAGCTTTGATCGTTCCCTGGTTCGTTCTCAGGTACCCGTTTGAGTTAACAATTGTTCGACATTAGGGTAACCAAATTGGTGCTGCTTTCTGGTGAGCATTCATGCATTGCAGCATAATTGTATATTTCGTGTCGAGTTGTTACTGACTTGGTTTACAGGCAAACCATTGCTGGTGAACACGGTCTCGATGGATCCGGCCAGTGAGTGATTCTGCAAGAAAAAGTTCCGGTCTTGAGGGACTTGAACGTTGACAACTGGGATTTCTATAGCTACACCGGATCTTCTGACCTCCAATTGGAGCGCATGAATGTCTACTTCAACGAGGTGTGCACGACCAAGACCCTTCCCTTCAGCAGCATACTAACTCATTGGAGGCAAAGGCCTCAAGCAAAAAATACGTTCCCCGTGCGGTTCTTGTTGATCTTGAGCCCGCCGCTCTCGATGCTGTCCGCGCCGGTCCTTTCGGTCAGCTCTTCCGCCCCGATAACGTCGTCTTCGGTCAGTCTGGTGCCGGAAACAACTGG

Name of Depositor CBS
Special Collection ATCC
Chain of Custody
ATCC <-- CBS <-- E Tunnela
Isolation
Man in onychomycosis and tinea manuum, Finland.
Cross References

Nucleotide (GenBank) : KJ606100 ITS including 5.8S rRNA gene

Nucleotide (GenBank) : KJ606148 D1/D2 region of 28S rRNA gene

Nucleotide (GenBank) : KJ606196 beta-tubulin gene

Nucleotide (GenBank) : ABWI00000000 Trichophyton equinum CBS 127.97, whole genome shotgun sequencing project

References

Achterman RR, et al. Sequenced dermatophyte strains: Growth rate, conidiation, drug susceptibilities, and virulence in an invertebrate model. Fungal Genet. Biol. 48(3): 335–341, 2011. PubMed: 21145410

Glenn AE, et al. Comparative genomic and phylogenetic investigation of the xenobiotic metabolizing arylamine N-acetyltransferase enzyme family. FEBS Lett 584: 3158-3164, 2010. PubMed: 20621844

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation