Microsporum canis Bodin, anamorph (ATCC® MYA-4605)

Alternate State: Arthroderma otae (Hasegawa et Usui) McGinnis et al., teleomorph  /  Strain Designations: CBS 113480  /  Product Format: frozen

Strain Designations CBS 113480
Alternate State Arthroderma otae (Hasegawa et Usui) McGinnis et al., teleomorph
Biosafety Level 2
Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Genome Sequenced Strain

Yes

Comments
Genome sequencing strain (Broad Institute, USA).
Dermatophyte fungus causes the head infection tinea capitis in humans and ringworm in cats and dogs.
Sequenced Data
ITS DNA sequence of MYA-4605

GTAGGTGAACCTGCGGAAGGATCATTAACGCGCAAGAGGTCGAAGTTGGCCCCCGAAGCTCTTCCGTCTCCCCCCCGGGCCTCCCGGGGAGGTTGCGGGCGGCGAGGGGTGCCTCCGGCCGCACGCCCATTCTTGTCTACTGACCCGGTTGCCTCGGCGGGCCGCGCCTGCTGTGCTACAGCGGCCGTTCGGGGGGGACGCCTGAGGGGGACTCTTGTTTCCTAGGCCACGCCCCGGGCAGCGCTCGCCGGAGGATTACTCTGGAAAACACACTCTTGAAAGAACATACCGTCTGAGCGAGCAACGCAAATCAGTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGCATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCAACCCCTCAAGCCCGGCTTGTGTGATGGACGACCGTCCCCCCTCCCCAGTAACCACCCACCGCTTAGGGGGGTGGGAGGGAGGGGGACGCGCCCGAAAAGCAGTGGTCAGGCCGCGATTCCGGCTCCTGGGCGAATGGGACATACCACCGCCTCCAGGACCGGCCGGCAGGCTGGCCTAACGCACCATGTATTATTCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATC

Name of Depositor CBS
Special Collection ATCC
Chain of Custody
ATCC <-- CBS <-- S Lampert
Isolation
Head of 3-year-old patient, Wurzburg, Germany.
Cross References

Nucleotide (GenBank) : GU291265 ITS including 5.8S rRNA gene

References

Achterman RR, et al. Sequenced dermatophyte strains: Growth rate, conidiation, drug susceptibilities, and virulence in an invertebrate model. Fungal Genet. Biol. 48(3): 335–341, 2011. PubMed: 21145410