Dekkera bruxellensis van der Walt (ATCC® MYA-4596)

Strain Designations: Y879 [CBS 2499]  /  Product Format: frozen

Permits and Restrictions

View Permits

Strain Designations Y879 [CBS 2499]
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Genome Sequenced Strain

Yes

Comments
Wine spoilage yeast.
Genome sequencing strain (the Joint Genome Institute at the Department of Energy, USA).
Sequenced mitochondrial genome.
Medium ATCC® Medium 28: Emmons' modification of Sabouraud's agar
ATCC® Medium 200: YM agar or YM broth
ATCC® Medium 1245: YEPD
Growth Conditions
Temperature: 24°C to 26°C
Atmosphere: Typical aerobic
Sequenced Data
D1D2 region of the 26S ribosomal RNA gene

TTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAATGGCGAATGAAGCGGCAAGAGCCCAAATTTGAAATCGGGCAACCGAGTTGTAATTTGGAGACGGGACACTAGAGAGGAGGAAGGCGATTAAGTGCCTTGGAACAGGCTGCCGTAGAGGGTGAGAGCCCCGTGAATCGCTGGAGACCGATCAATTAGTGCCCGCCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTATATTCCATCTAAGGCTAAATATTAGCGAGAGACCGATAGCAAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGGAAAGAGAGTGAAATAGTACGTGAAATTGTTGAAAGGGAAGGGTATTTGATCCGACATGGTGTTTAGCAGCGGCCCGTTCCTCGTGGATGGGTGCACCTGGTTTACACTGGGCCAGCATCGGTTCTGGGAGCCATATACGGGGTTCGTGAATGTGGCCCTTCGATTCTGTCGGAGGGTGTTATAGCGCGGACATCTTGTGGCTAGCCGGGACCGGGGACTGCGGTGACTTGTCACCAAGGATGCTGGCAGAACGAGCAAATACCACCCGTCTTG

Name of Depositor J Piskur
Special Collection ATCC
Chain of Custody
ATCC <-- J Piskur <-- CBS
Isolation
Wine, Medoc, France.
Cross References

Nucleotide (GenBank) : GU291284 D1/D2 region of 28S rRNA gene

Nucleotide (GenBank) : AHMD00000000 Brettanomyces bruxellensis CBS 2499, whole genome shotgun sequencing project

References

Woolfit M, et al. Genome survey sequencing of the wine spoilage yeast Dekkera (Brettanomyces) bruxellensis. Eukaryot. Cell 6: 721-733, 2007. PubMed: 17277171

Crauwels S, et al. Assessing genetic diversity among Brettanomyces yeasts by DNA fingerprinting and whole-genome sequencing. Appl. Environ. Microbiol. 80: 4398-4413, 2014. PubMed: 24814796

Galafassi S, et al. Osmotic stress response in the wine yeast Dekkera bruxellensis. Food Microbiol 36: 316-319, 2013. PubMed: 24010612

Piskur J, et al. The genome of wine yeast Dekkera bruxellensis provides a tool to explore its food-related properties. Int J Food Microbiol 157: 202-209, 2012. PubMed: 22663979

Prochazka E, et al. Mitochondrial genome from the facultative anaerobe and petite-positive yeast Dekkera bruxellensis contains the NADH dehydrogenase subunit genes. FEMS Yeast Res 10: 545-557, 2010. PubMed: 20528950

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation