Aspergillus brasiliensis Varga et al. (ATCC® MYA-4553)

Strain Designations: CBS 101740 [IBT 21946, IMI 381727]  /  Product Format: frozen

Strain Designations CBS 101740 [IBT 21946, IMI 381727]
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain yes
Preceptrol® no
Genome Sequenced Strain

Yes

Comments
A black aspergillus in Aspergillus section Nigri.
Genome sequencing strain (the Joint Genome Institute at the Department of Energy, USA).
Medium ATCC® Medium 200: YM agar or YM broth
ATCC® Medium 323: Malt agar medium
ATCC® Medium 336: Potato dextrose agar (PDA)
Growth Conditions
Temperature: 24°C to 26°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

ATCATTACCGAGTGCGGGTCCTTTGGGCCCAACCTCCCATCCGTGTCTATTGTACCCTGTTGCTTCGGCGGGCCCGCCGCTTGTCGGCCGCCGGGGGGGCGCCTCTGCCCCCCGGGCCCGTGCCCGCCGGAGACCCCAACACGAACCCTGTCTGAAAGCGTGCAGTCTGAGTCGATTGTTTGCAATCAGTTAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCCCGGCTTGTGTGTTGGGTCGCCGTCCCCTCTCTCCGGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGATCCTCGAGCGTATGGGGCTTTGTCACATGCTCTGTAGGATTGGCCGGCGCCTGCCGACGTTTTCCAACCATTCTTTCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATC

Name of Depositor CBS
Special Collection ATCC
Chain of Custody
ATCC <-- CBS
Isolation
Soil, Pedreira, Sao Paulo, Brazil.
Cross References

Nucleotide (GenBank) : FJ810517 ITS including 5.8S rRNA gene

Nucleotide (GenBank) : LJXV00000000 Aspergillus brasiliensis CBS 101740, whole genome shotgun sequencing project

References

Varga J, et al. Aspergillus brasiliensis sp. nov., a biseriate black Aspergillus species with world-wide distribution. Int. J. Syst. Evol. Microbiol. 57: 1925-1932, 2007.