Aspergillus brasiliensis Varga et al. (ATCC® MYA-4553)

Strain Designations: CBS 101740 [IBT 21946, IMI 381727]  /  Product Format: frozen

Strain Designations CBS 101740 [IBT 21946, IMI 381727]
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format frozen
Type Strain yes
Preceptrol® no
Genome Sequenced Strain

Yes

Comments
A black aspergillus in Aspergillus section Nigri.
Genome sequencing strain (the Joint Genome Institute at the Department of Energy, USA).
Medium ATCC® Medium 336: Potato dextrose agar (PDA)
Growth Conditions
Temperature: 25.0°C
Sequenced Data
>ITS DNA sequence for MYA-4553

ATCATTACCGAGTGCGGGTCCTTTGGGCCCAACCTCCCATCCGTGTCTATTGTACCCTGTTGCTTCGGCGGGCCCGCCGCTTGTCGGCCGCCGGGGGGGCGCCTCTGCCCCCCGGGCCCGTGCCCGCCGGAGACCCCAACACGAACCCTGTCTGAAAGCGTGCAGTCTGAGTCGATTGTTTGCAATCAGTTAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCCCGGCTTGTGTGTTGGGTCGCCGTCCCCTCTCTCCGGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGATCCTCGAGCGTATGGGGCTTTGTCACATGCTCTGTAGGATTGGCCGGCGCCTGCCGACGTTTTCCAACCATTCTTTCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATC

Name of Depositor CBS
Special Collection ATCC
Chain of Custody
ATCC <-- CBS
Isolation
Soil, Pedreira, Sao Paulo, Brazil.
Cross References

Nucleotide (GenBank) : FJ810517 ITS including 5.8S rRNA gene

References

Varga J, et al. Aspergillus brasiliensis sp. nov., a biseriate black Aspergillus species with world-wide distribution. Int. J. Syst. Evol. Microbiol. 57: 1925-1932, 2007.