Advanced Search

Spathaspora passalidarum Nguyen et al. (ATCC® MYA-4345™)

Strain Designations: 11-Y1 [CBS 10155, NRRL Y-27907]  /  Product Format: frozen

Permits and Restrictions

View Permits

Strain Designations 11-Y1 [CBS 10155, NRRL Y-27907]
Application
Ferments pentose (xylose).
Bioethanol production
Biosafety Level 1
Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain yes
Preceptrol® no
Genome Sequenced Strain

Yes

Comments
Ferments pentose (xylose)
Insect associated yeast
Genome sequencing strain (the Joint Genome Institute at the Department of Energy, USA)
Morphology After 6 days on YM medium at 25°C, colonies are white, smooth, butyrous. Cells are globose or subglobose, single or with bud. Pseudohyphae are not observed.
Medium ATCC® Medium 28: Emmons' modification of Sabouraud's agar
ATCC® Medium 200: YM agar or YM broth
ATCC® Medium 1245: YEPD
Growth Conditions
Temperature: 24°C to 26°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

TTTCCGTAGGTGAACCTGCGGAAGGATCATTACTGTTTCTGCGCTTCATTGCGCGATCTACACACTGTGATTTTTTTTAATCAACTTGCTTTGGTCTGGCGCGAGTCGGGCCAGAGGTAAACACACAAACATTTTATTTAATTGTCAAACTTTAACTAATTGTTAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATATGAATTGCAGATATTCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGAGGGCATGCCTGTTTGAGCGTCATTTCTCTCTCAAGCCCCCGGGTTTGGTGTTGAGTGATACTCCCAGTCAGACTAGGCGTTTTCTTGAAAGGAATCGGCGTGAGCTACGACAATGTATTAGGTTCATCCAACTCGTTGTCAGCAGCGCACGCGCCCTTACAAATCAACCTAGTTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGA


D1D2 region of the 26S ribosomal RNA gene

ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTTAGTAGCGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCGTATTCTGCGTCCGAGTTGTAATTTGAAGAAGGTATCTTTGGGTCTGGCGCTTGTCTATGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTGCGATGAGCAGTCCAGATCTATGTAAAGTTCCTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCTTGCGATCAGACTTGGTATTTTGTATGTCTTGCTCTCGGGCGGGGCCTCTGCAGTTTACTGGGCCAGCATCGGTTCGTGCGGCAGGACAATTGCAGAGAAATGTGGCACGACTTCGGTTGTGTGTTATAGTCTTTGTCGATACTGCCTGCGTGGACCGAGGACTGCGTCTTATGACTAGGATGCTGGCATAATGATCGTAAGCCGCCCGTCTTGAAACACGGAC
Morphology After 6 days on YM medium at 25°C, colonies are white, smooth, butyrous. Cells are globose or subglobose, single or with bud. Pseudohyphae are not observed.
Name of Depositor SO Suh
Special Collection ATCC
Chain of Custody
ATCC <-- SO Suh
Isolation
Gut of Odontotaenius disjunctus (Passalidae), West Feliciana Parish, LA, USA.
Cross References

Nucleotide (GenBank) : FJ614681 D1/D2 region of 28S rRNA gene

Nucleotide (GenBank) : FJ623614 ITS including 5.8S rRNA gene

Nucleotide (GenBank) : KC507444 EF-1 alpha gene

Nucleotide (GenBank) : KC507413 RPB1 gene

Nucleotide (GenBank) : KC512839 RPB2 gene

Nucleotide (GenBank) : AEIK00000000 Spathaspora passalidarum NRRL Y-27907, whole genome shotgun sequencing project

References

Nguyen NH, et al. Morphological and ecological similarities: wood-boring beetles assoicated with novel xylose-fermenting yeasts, Spathaspora passalidarum gen. sp. nov. and Candida jeffriesii sp. nov. Mycol. Res. 110: 1232-1241, 2006.

Wohlbach DJ, et al. Comparative genomics of xylose-fermenting fungi for enhanced biofuel production. Proc. Natl. Acad. Sci. USA 108: 13212-13217, 2011. PubMed: 21788494

Suh SO, et al. Scheffersomyces parashehatae f.a., sp. nov., Scheffersomyces xylosifermentans f.a., sp. nov., Candida broadrunensis sp. nov., and Candida manassasensis sp. nov., four novel yeasts associated with wood- ingesting insects and their ecological and biofuel implications. Int. J. Syst. Evol. Microbiol. 63: 4330-4339, 2013. PubMed: 24014624

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation
Product Sheet
Product Sheet
Certificate of Analysis
Certificate of Analysis
MSDS
MSDS