Advanced Search

Spathaspora passalidarum Nguyen et al. (ATCC® MYA-4345™)

Strain Designations: 11-Y1 [CBS 10155, NRRL Y-27907]  /  Product Format: frozen

Permits and Restrictions

View Permits

Strain Designations 11-Y1 [CBS 10155, NRRL Y-27907]
Application
Ferments pentose (xylose).
Bioethanol production
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.
Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain yes
Preceptrol® no
Genome Sequenced Strain

Yes

Comments
Ferments pentose (xylose)
Insect associated yeast
Genome sequencing strain (the Joint Genome Institute at the Department of Energy, USA)
Morphology After 6 days on YM medium at 25°C, colonies are white, smooth, butyrous. Cells are globose or subglobose, single or with bud. Pseudohyphae are not observed.
Medium ATCC® Medium 28: Emmons' modification of Sabouraud's agar
ATCC® Medium 200: YM agar or YM broth
ATCC® Medium 1245: YEPD
Growth Conditions
Temperature: 24°C to 26°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

TTTCCGTAGGTGAACCTGCGGAAGGATCATTACTGTTTCTGCGCTTCATTGCGCGATCTACACACTGTGATTTTTTTTAATCAACTTGCTTTGGTCTGGCGCGAGTCGGGCCAGAGGTAAACACACAAACATTTTATTTAATTGTCAAACTTTAACTAATTGTTAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATATGAATTGCAGATATTCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGAGGGCATGCCTGTTTGAGCGTCATTTCTCTCTCAAGCCCCCGGGTTTGGTGTTGAGTGATACTCCCAGTCAGACTAGGCGTTTTCTTGAAAGGAATCGGCGTGAGCTACGACAATGTATTAGGTTCATCCAACTCGTTGTCAGCAGCGCACGCGCCCTTACAAATCAACCTAGTTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGA


D1D2 region of the 26S ribosomal RNA gene

ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTTAGTAGCGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCGTATTCTGCGTCCGAGTTGTAATTTGAAGAAGGTATCTTTGGGTCTGGCGCTTGTCTATGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTGCGATGAGCAGTCCAGATCTATGTAAAGTTCCTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCTTGCGATCAGACTTGGTATTTTGTATGTCTTGCTCTCGGGCGGGGCCTCTGCAGTTTACTGGGCCAGCATCGGTTCGTGCGGCAGGACAATTGCAGAGAAATGTGGCACGACTTCGGTTGTGTGTTATAGTCTTTGTCGATACTGCCTGCGTGGACCGAGGACTGCGTCTTATGACTAGGATGCTGGCATAATGATCGTAAGCCGCCCGTCTTGAAACACGGAC
Morphology After 6 days on YM medium at 25°C, colonies are white, smooth, butyrous. Cells are globose or subglobose, single or with bud. Pseudohyphae are not observed.
Name of Depositor SO Suh
Special Collection ATCC
Chain of Custody
ATCC <-- SO Suh
Isolation
Gut of Odontotaenius disjunctus (Passalidae), West Feliciana Parish, LA, USA.
Cross References

Nucleotide (GenBank) : FJ614681 D1/D2 region of 28S rRNA gene

Nucleotide (GenBank) : FJ623614 ITS including 5.8S rRNA gene

Nucleotide (GenBank) : KC507444 EF-1 alpha gene

Nucleotide (GenBank) : KC507413 RPB1 gene

Nucleotide (GenBank) : KC512839 RPB2 gene

Nucleotide (GenBank) : AEIK00000000 Spathaspora passalidarum NRRL Y-27907, whole genome shotgun sequencing project

References

Nguyen NH, et al. Morphological and ecological similarities: wood-boring beetles assoicated with novel xylose-fermenting yeasts, Spathaspora passalidarum gen. sp. nov. and Candida jeffriesii sp. nov. Mycol. Res. 110: 1232-1241, 2006.

Wohlbach DJ, et al. Comparative genomics of xylose-fermenting fungi for enhanced biofuel production. Proc. Natl. Acad. Sci. USA 108: 13212-13217, 2011. PubMed: 21788494

Suh SO, et al. Scheffersomyces parashehatae f.a., sp. nov., Scheffersomyces xylosifermentans f.a., sp. nov., Candida broadrunensis sp. nov., and Candida manassasensis sp. nov., four novel yeasts associated with wood- ingesting insects and their ecological and biofuel implications. Int. J. Syst. Evol. Microbiol. 63: 4330-4339, 2013. PubMed: 24014624

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation
Product Sheet
Product Sheet
Certificate of Analysis
Certificate of Analysis
SDS
SDS