Metarhizium anisopliae (Metschnikoff) Sorokin (ATCC® MYA-3075)

Strain Designations: ARSEF 23  /  Product Format: frozen

Deposited As Metarhizium anisopliae
Strain Designations ARSEF 23
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Genome Sequenced Strain

Yes

Comments
entomopathogenic fungus
genome sequencing strain (Shanghai Institutes for Biological Sciences (SIBS), China)
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

AGGGATCATTACCGAGTTATCCAACTCCCAACCCCTGTGAATTATACCTTTAATTGTTGCTTCGGCGGGACTTCGCGCCCGCCGGGGACCCAAACCTTCTGAATTTTTTAATAAGTATCTTCTGAGTGGTTAAAAAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGTCAGTATTCTGGCGGGCATGCCTGTTCGAGCGTCATTACGCCCCTCAAGTCCCCTGTGGACTTGGTGTTGGGGATCGGCGAGGCTGGTTTTCCAGCACAGCCGTCCCTTAAATTAATTGGCGGTCTCGCCGTGGCCCTCCTCTGCGCAGTAGTAAAACACTCGCAACAGGAGCCCGGCGCGGTCCACTGCCGTAAAACCCCCCAACTTTTTATAGTTGACCTCGAATCAGGTAGGACTACCCGCTGAACTTAAG


D1D2 region of the 28S ribosomal RNA gene

CATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGTCCCCAGGGCCCGAGTTGTAATTTGCAGAGGATGCTTTTGGTGAGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCCGTCTGGTTGGATACCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTATATGTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGTACGTGAAATTGTTGAAAGGGAAGCACTTATGACCAGACTTGGCCCCGGTGAATCATCCAGCGGTTCCCGCTGGTGCACTTTGCCGGGGTTCAGGCCAGCATCAGTTCGCTCCGGGGGATAAAGGCTTTGGGAATGTGGCTCCCTCGGGAGTGTTATAGCCCATTGCGCAATACCCTGTGGCGGGCTGAGGTTCGCGCTTTATGCAAGGATGCTGGCATAATGGTCATCAGTGA

Name of Depositor DW Roberts
Special Collection NSF - Mycology
Chain of Custody
ATCC <-- DW Roberts
Cross References

Nucleotide (GenBank) : ADNJ00000000 Metarhizium anisopliae ARSEF 23, whole genome shotgun sequencing project

References

Braga GUL, et al. Variability in response to UV-B among species and strains of Metarhizium isolated from sites at latitudes from 61 degrees N to 54 degrees S. J. Invertebr. Pathol. 78: 98-108, 2001. PubMed: 11812112

Braga GUL, et al. Effect of UV-B on coidia and germlings of the entomopathogenic hyphomycete Metarhizium anisopliae. Mycol. Res. 105: 874-882, 2001.

Braga GU, et al. Both solar UVA and UVB radiation impair conidial culturability and delay germination in the entomopathogenic fungus Metarhizium anisopliae. Photochem. Photobiol. 74: 734-739, 2001. PubMed: 11723803

Gao Q, et al. Genome sequencing and comparative transcriptomics of the model entomopathogenic fungi Metarhizium anisopliae and M. acridum. PLoS Genetics 7: e1001264, 2011.