Trichosporon asahii Akagi ex Sugita et al. (ATCC® 90039)

Strain Designations: CBS 2479 [JCM 2466]  /  Product Format: freeze-dried

Permits and Restrictions

View Permits

Strain Designations CBS 2479 [JCM 2466]
Application
Biomedical Research and Development Material
Biosafety Level 2

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain yes
Preceptrol® no
Genome Sequenced Strain

Yes

Comments Genome sequencing strain (Beijing Military Command General Hospital, China; RIKEN Center for Life Science Technologies, Japan)
Medium ATCC® Medium 28: Emmons' modification of Sabouraud's agar
ATCC® Medium 200: YM agar or YM broth
ATCC® Medium 1245: YEPD
Growth Conditions
Temperature: 24°C to 26°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

GGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAGTGATTGCCTTTATAGGCTTATAACTATATCCACTTACACCTGTGAACTGTTCTACTACTTGACGCAAGTCGAGTATTTTTACAAACAATGTGTAATGAACGTCGTTTTATTATAACAAAATAAAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCAGCTTGCGCTCTCTGGTATTCCGGAGAGCATGCCTGTTTCAGTGTCATGAAATCTCAACCACTAGGGTTTCCTAATGGATTGGATTTGGGCGTCTGCGATTTCTGATCGCTCGCCTTAAAAGAGTTAGCAAGTTTGACATTAATGTCTGGTGTAATAAGTTTCACTGGGTCCATTGTGTTGAAGCGTGCTTCTAATCGTCCGCAAGGACAATTACTTTGACTCTGGCCTGAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAA


D1D2 region of the 26S ribosomal RNA gene

ATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAATTTGAAATCTGGCAGTCTTCGATTGTCCGAGTTGTAATCTATAGAGGCGTTTTCCGTGCCGGACCGTGTCCAAGTCTCCTGGAAAGGAGTATCAAAGAGGGTGATAATCCCGTACTTAACACGACCACCGGTGCTCTGTGATACGTCTTCTACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTGAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGATTGAAGTCAGTCGTGTTCTTTGGATTCAGCCAGTTCTGCTGGTCTACTTCCTTGGAACGGGTCAACATCAGTTTTGTCCGGTGGATAAAGGTAGTAGGAATGTGACTTCTCCGGAAGTGTTATAGCCTATTATCACATACACTGGGTGAGACTGAGGACTGCAGCTCGCCTTTATGGCCGGCCTTCGGGCACGTTCGAGCTTAGGATGTTGACATAATGGCTTTAAACGAC

Name of Depositor CBS
Chain of Custody
ATCC <-- CBS <-- M. Ota
Isolation
Skin, Japan
Cross References

Nucleotide (GenBank) : AF105393 26S ribosomal RNA gene, partial sequence

Nucleotide (GenBank) : BCLT00000000 Trichosporon asahii strain JCM 2466, whole genome shotgun sequencing project

Nucleotide (GenBank) : ALBS00000000 Trichosporon asahii var. asahii CBS 2479, whole genome shotgun sequencing project

References

Akagi S. Uber eine neue mykotische Hautkrankheit "Trichosporia cutis psoriatiformis progressiva Asahi et Agaki". [In Japanese]. Jpn. J. Dermatol. Urol. 29: 53-55, 1929.

Akagi S. Uber eine neue mykotische Hautkrankheit "Trichosporia cutis psoriatiformis progressiva Asahi et Agaki". [In Japanese]. Jpn. J. Dermatol. Urol. 29: 733-774, 1929.

Fell JW, et al. Biodiversity and systematics of basidiomycetous yeasts as determined by large-subunit rDNA D1/D2 domain sequence analysis. Int. J. Syst. Evol. Microbiol. 50: 1351-1371, 2000. PubMed: 10843082

Hamano K, et al. Genome profiling (GP) as an effective tool for monitoring culture collections: A case study with Trichosporon. J. Microbiol Methods 89: 119-128, 2012. PubMed: 22401825

Guo LN, et al. Three-locus identification, genotyping, and antifungal susceptibilities of medically important Trichosporon species from China. J. Clin. Microbiol. 49: 3805-3811, 2011. PubMed: 21900517

Chagas-Neto TC, et al. Bloodstream infections due to Trichosporon spp.: species distribution, Trichosporon asahii genotypes determined on the basis of ribosomal DNA intergenic spacer 1 sequencing, and antifungal susceptibility testing. J. Clin. Microbiol. 47: 1074-1081, 2009. PubMed: 19225102

Yang R, et al. Disseminated trichosporonosis in China. Mycoses 46: 519-523, 2003. PubMed: 14641628

Sugita T, et al. Sequence analysis of the ribosomal DNA intergenic spacer 1 regions of Trichosporon species. J. Clin. Microbiol. 40: 1826-1830, 2002. PubMed: 11980969

Abliz P, et al. Identification of the first isolates of Trichosporon asahii var. asahii from disseminated trichosporonosis in China. Diagn. Microbiol. Infect. Dis. 44: 17-22, 2002. PubMed: 12376026

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation