Magnaporthe poae Landschoot et Jackson (ATCC® 64411)

Strain Designations: 73-15  /  Product Format: frozen

Permits and Restrictions

View Permits

Strain Designations 73-15
Biosafety Level 1
Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Type Strain no
Preceptrol® no
Genome Sequenced Strain

Yes

Mating Type mating type A
Comments
Genetic variation
Genome sequencing strain (Broad Institute, USA).
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal   transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.

CTTACCTTTACTGTTGCTTCGGCGGCGCCCCGTCGCCGCCGGAGGTTCAAAACCCTGAATTTTAGTGTATCTCTGAGTACGAAAAGAACCTGAAAAATTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCGGTATTCCGGCGGGCATGCCTGTCCGAGCGTCATTTCACCACTCAAGCCCAGCTTGGTGTTGGGGCACCCGGCCGCCTGGCGGCCGGGGCCCCCAAGTACATCGGCGGTCCCGCTGGGGGCTCCGAGCGCAGTAGCTCGCGGTAAAACGCGCCCTCGCTCGGCGGCCTCTTCGGACTTCCAGCCGCTAAAACCCGCGTCCACCAGGACGCCCCTTTCGAGTTGACCTCGGATCA

Name of Depositor PJ Landschoot
Isolation
wheat; single-spore isolate
Cross References

Nucleotide (GenBank) : AF395973 Magnaporthe poae actin (act) gene, partial cds.

Nucleotide (GenBank) : AF396002 Magnaporthe poae beta-tubulin gene, partial cds.

Nucleotide (GenBank) : AF396032 Magnaporthe poae calmodulin (cal) gene, partial cds.

Complete Genome (GenBank) : ADBL00000000 Magnaporthe poae ATCC 64411, whole genome shotgun sequencing project

References

Huff DR, et al. Use of random amplified polymorphic DNA markers for the detection of genetic variation in Magnaporthe poae. Phytopathology 84: 1312-1316, 1994.

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
  • USDA APHIS PPQ Permit 526, plant pathogens permit must be obtained and a copy of the permit must be sent to ATCC in advance of shipment. Isolation information for this item is required by USDA. Please check our website or contact Technical Service for assistance. Domestic isolates are easier to obtain than foreign isolates.
Basic Documentation