Magnaporthe poae Landschoot et Jackson (ATCC® 64411)

Strain Designations: 73-15  /  Product Format: frozen

Strain Designations 73-15
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Genome Sequenced Strain

Yes

Mating Type mating type A
Comments
Genetic variation
Genome sequencing strain (Broad Institute, USA).
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal   transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.

CTTACCTTTACTGTTGCTTCGGCGGCGCCCCGTCGCCGCCGGAGGTTCAAAACCCTGAATTTTAGTGTATCTCTGAGTACGAAAAGAACCTGAAAAATTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCGGTATTCCGGCGGGCATGCCTGTCCGAGCGTCATTTCACCACTCAAGCCCAGCTTGGTGTTGGGGCACCCGGCCGCCTGGCGGCCGGGGCCCCCAAGTACATCGGCGGTCCCGCTGGGGGCTCCGAGCGCAGTAGCTCGCGGTAAAACGCGCCCTCGCTCGGCGGCCTCTTCGGACTTCCAGCCGCTAAAACCCGCGTCCACCAGGACGCCCCTTTCGAGTTGACCTCGGATCA

Name of Depositor PJ Landschoot
Isolation
Wheat; single-spore isolate
Cross References

Nucleotide (GenBank) : AF395973 Magnaporthe poae actin (act) gene, partial cds.

Nucleotide (GenBank) : AF396002 Magnaporthe poae beta-tubulin gene, partial cds.

Nucleotide (GenBank) : AF396032 Magnaporthe poae calmodulin (cal) gene, partial cds.

Nucleotide (GenBank) : ADBL00000000 Magnaporthe poae ATCC 64411, whole genome shotgun sequencing project

References

Huff DR, et al. Use of random amplified polymorphic DNA markers for the detection of genetic variation in Magnaporthe poae. Phytopathology 84: 1312-1316, 1994.

Couch BC, Kohn LM. A multilocus gene genealogy concordant with host preference indicates segregation of a new species, Magnaporthe oryzae, from M. grisea. Mycologia 94: 683-693, 2002. PubMed: 21156541