Trichoderma reesei Simmons (ATCC® 26921)

Strain Designations: QM 9414 [3019, CBS 392.92, T.V. B118]  /  Product Format: freeze-dried

Permits and Restrictions

View Permits

Deposited As Trichoderma viride Persoon : Fries
Strain Designations QM 9414 [3019, CBS 392.92, T.V. B118]
Application
Produces 17 beta-hydroxysteroid dehydrogenase Estradiol 17-beta-dehydrogenase-1, Hydroxysteroid dehydrogenase 17 beta, type 1, hydroxysteroid 17-beta dehydrogenase 1
Produces 20 beta-hydroxysteroid dehydrogenase
Produces acetylesterase acetyl esterase
Produces alpha-1,2-glucuronidase
Produces alpha-L-arabinofuranosidase alpha-1,3-arabinosidase
Produces endoglucanase
Produces endoglucanase III EIII
Produces endoglucanase-cellobiohydrolase complex
Produces exo-1,4-beta-D-xylosidase beta-xylosidase
Produces exo-cellobiohydrolase avicelase, endoglucanase I
Produces glucosidase, beta; acid Glucosidase, beta, acid, glucocerebrosidase
Produces hydrolase
Produces mannan endo-1,4-beta-mannosidase beta-mannanase, mannanase
Produces paracelsin
Transformation host
Produces extracellular hydrolases
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Genome Sequenced Strain

Yes

Comments
Produces 1.5-2.0 times more cellulase on cellulose medium than ATCC 24449
EIII core protein of endoglucanase
Ethanol- and polyene-sensitive
Mitochondrial genome sequenced strain (University of Sao Paulo, Brazil).
Genome sequencing strain (the Joint Genome Institute at the Department of Energy, USA).
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

GGTCTCCGTTGGTGAACCAGCGGAGGGATCATTACCGAGTTTACAACTCCCAAACCCCAATGTGAACGTTACCAATCTGTTGCCTCGGCGGGATTCTCTGCCCCGGGCGCGTCGCAGCCCCGGATCCCATGGCGCCCGCCGGAGGACCAACTCAAACTCTTTTTTCTCTCCGTCGCGGCTTCCGTCGCGGCTCTGTTTTACCTTTGCTCTGAGCCTTTCTCGGCGACCCTAGCGGGCGTCTCGAAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTCCGAGCGTCATTTCAACCCTCGAACCCCTCCGGGGGGTCGGCGTTGGGGATCGGCCCCTCACCGGGCCGCCCCCGAAATACAGTGGCGGTCTCGCCGCAGCCTCTCCTGCGCAGTAGTTTGCACACTCGCACCGGGAGCGCGGCGCGGCCACAGCCGTAAAACACCCCAAACTCTGAAATGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAA


D1D2 region of the 28S ribosomal RNA gene

ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCTTTCGGGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGCAAGGCGCCGCCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTCTGGCTGGCCGCCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTATATGTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGAGGGTTAAATAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGGGCGCGGCGGATCATCCGGGGTTCTCCCCGGTGCACTTCGCCGTGTCCAGGCCAGCATCAGTTCGTCGCGGGGGAAAAAGGCTTCGGGAACGTGGCTCCCCTGGGAGTGTTATAGCCCGTTGCATAATACCCTGCGGTGGACTGAGGACCGCGCATCTGCAAGGATGCTGGCGTAATGGTCACCAGCGAC


calmodulin gene

TCTTTGTGAGTTTTTTGAACGTCCTTTACTGCGGCAACCCGGTAGGGGGGTTGTTTTCAGGGTGCTGACCGAGCTGCTCTACAGGACAAGGACGGCGATGGTACGTGATGGCGAGTGACGCGACAACACACCTATTGCCCTCTCGACGAAGCCGCACCGAAGCACTTTGTGCCGATCGATCACTCTATCGTCGACTCGAATCATGATACATGGACAAGAAACTGACAGGCTTGACCTCGTAGGCCAGATCACCACCAAGGAGTTGGGCACCGTGATGCGCTCTCTCGGCCAGAACCCTTCCGAGTCGGAGCTGCAGGACATGATCAACGAGGTTGACGCCGACAACAACGGCTCCATCGACTTCCCTGGTATGTGAATTGTTGGGAGATTTGGTGGTTGAGGTATACGGGCTGACGTGGAGCGGTGAAGAATTTCTCA


Elongation factor 1-alpha

CCAGGCCGACTGCGCTATCCTCATCATCGCTGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCTCTGCTCGCCTACACCCTGGGTGTCAAGCAGCTCATCGTCGCCATCAACAAGATGGACACTGCCAACTGGGCCGAGGCTCGTTACCAGGAAATCATCAAGGAGACTTCCAACTTCATCAAGAAGGTCGGCTTCAACCCCAAGGCCGTTGCTTTCGTCCCCATCTCCGGCTTCAACGGTGACAACATGCTCACCCCCTCCACCAACTGCCCCTGGTACAAGGGCTGGGAGAAGGAGACCAAGGCTGGCAAGTTCACCGGCAAGACCCTCCTTGAGGCCATCGACTCCATCGAGCCCCCCAAGCGTCCCACGGACAAGCCCCTGCGTCTTCCCCTCCAGGACGTCTACAAGATCGGTGGTATCGGAACAGTTCCCGTCGGCCGTATCGAGACTGGTGTCCTCAAGCCCGGTATGGTCGTTACCTTCGCTCCCTCCAACGTCACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTCGCTGAGGGCCAGCCTGGTGACAACGTTGGTTTCAACGTGAAGAACGTTTCCGTCAAGGAAATCCGCCGTGGCAACGTTGCCGGTGACTCCAAGAACGACCCCCCCATGGGCGCCGCTTCTTTCACCGCCCAGGTCATCGTCATGAACCACCCCGGCCAGGTCGGTGCCGGCTACGCCCCCGTCCTCGACTGCCACACTGCCCACATTGCCTGCAAGTTCGCCGAGCTCCTCGAGAAGATCGACCGCCGTACCGGTAAGGCTACCGAGTCTGCCCCCAAGTTCATCAAGTCTGGTGACTCCGCCATCGTCAAGATGATCCCCTCCAAGCCCATGTGCGTTGAGGCTTTCACCGACTACCCTCCCCTGGGTCGTTTCGCCGTCCGTGACAT

Name of Depositor QM
Chain of Custody
ATCC <-- QM <-- M Mandels 3019
Isolation
Mutant of ATCC 24449, QM 9123
Cross References

Nucleotide (GenBank) : KU729028 ITS including 5.8S rRNA gene

Nucleotide (GenBank) : KU729112 D1/D2 region of 28S rRNA gene

Nucleotide (GenBank) : KU933433 elongation factor (EF) 1-alpha gene

Nucleotide (GenBank) : KU933408 calmodulin gene

Nucleotide (GenBank) : M81127 Trichoderma reesei TR1 promoter.

Nucleotide (GenBank) : X70232 T. reesei cbh2 gene (promoter region).

Nucleotide (GenBank) : D63514 creA gene for DNA-binding protein, complete coding sequence

References

Sprey B, Lambert C. Heterogeneity of cellulase complexes from Trichoderma reesei: a preparative isoelectric focusing study of some extracellular hydrolases. FEMS Microbiol. Lett. 23: 227-232, 1984.

Stahlberg J, et al. A binding-site-deficient, catalytically active, core protein of endoglucanase III from the culture filtrate of Trichoderma reesei. Eur. J. Biochem. 173: 179-183, 1988. PubMed: 3356188

Mach RL, et al. Transformation of Trichoderma reesei based on hygromycin B resistance using homologous expression signals. Curr. Genet. 25: 567-570, 1994. PubMed: 8082210

Haab D, et al. Protein hypersecretory Trichoderma reesei mutant RUT C-30 displays increased ethanol and polyene resistance. J. Biotechnol. 29: 97-108, 1993.

Lanisnik T, et al. Fungal 17 beta-hydroxysteroid dehydrogenase. FEMS Microbiol. Lett. 78: 49-52, 1992. PubMed: 1334892

Dominguez JM, et al. Spontaneous aggregation of endoglucanase 1 from Trichoderma reesei QM 9414. Biotechnol. Appl. Biochem. 15: 236-246, 1992.

Takashima S, et al. Cloning of a gene encoding a putative carbon catabolite repressor from Trichoderma reesei. Biosci. Biotechnol. Biochem. 60: 173-176, 1996. PubMed: 8824842

Rogalski J, et al. Affinity chromatography of 1 4-beta glucosidase from Trichoderma reesei QM 9414. Acta Biotechnol. 11: 485-494, 1991.

Messner R, Kubicek CP. Evidence for a single specific beta glucosidase in cell walls from Trichoderma reesei QM9414. Enzyme Microb. Technol. 12: 685-690, 1990.

Estrada P, et al. Kinetic mechanism of beta-glucosidase from Trichoderma reesei QM 9414. Biochim. Biophys. Acta 1033: 298-304, 1990. PubMed: 2107875

Sprey B, Bochem HP. Formation of cross-fractures in cellulose microfibril structure by an endoglucanase-cellobiohydrolase complex from Trichoderma reesei. FEMS Microbiol. Lett. 106: 239-243, 1993. PubMed: 8454189

Bruckner H, Graf H. Paracelsin, a peptide antibiotic containing alpha-aminoisobutyric acid, isolated from Trichoderma reesei Simmons. Part A. Experientia 39: 528-530, 1983. PubMed: 6406260

Przybylski M, et al. Elucidation of structure and microheterogeneity of the polypeptide antibiotics paracelsin and trichotoxin A-50 by fast atom bombardment mass spectrometry in combination with selective in situ hydrolysis. Biomed. Mass Spectrom. 11: 569-582, 1984.

Poutanen K, et al. The hemicellulolytic activities of Trichoderma reesei. Proc. 4th Eur. Congr. Biotechnol. 2: 90, 1987.

Sternberg D. A method for increasing cellulase production by Trichoderma viride. Biotechnol. Bioeng. 18: 1751-1760, 1976.

Zembek P, et al. Cloning and functional analysis of the dpm2 and dpm3 genes from Trichoderma reesei expressed in a Saccharomyces cerevisiae dpm1Δ mutant strain. Biol Chem 392: 517-527, 2011. PubMed: 21521073

Konno N, et al. Cloning of the Trichoderma reesei cDNA encoding a glucuronan lyase belonging to a novel polysaccharide lyase family. Appl Environ Microbiol 75: 101-107, 2009. PubMed: 18978091

Ramos AS, et al. Oxygen- and glucose-dependent expression of Trhxt1, a putative glucose transporter gene of Trichoderma reesei. Biochemistry 45: 8184-8192, 2006. PubMed: 16800643

Seiboth B, et al. The galactokinase of Hypocrea jecorina is essential for cellulase induction by lactose but dispensable for growth on d-galactose. Mol Microbiol 51: 1015-1025, 2004. PubMed: 14763977

Wu Z, et al. 18S rRNA gene variation among common airborne fungi, and development of specific oligonucleotide probes for the detection of fungal isolates. Appl Environ Microbiol 69: 5389-5397, 2003. PubMed: 12957927

Seiboth B, Hofmann G, Kubicek CP. Lactose metabolism and cellulase production in Hypocrea jecorina: the gal7 gene, encoding galactose-1-phosphate uridylyltransferase, is essential for growth on galactose but not for cellulase induction. Mol Genet Genomics 267: 124-132, 2002. PubMed: 11919723

Chambergo FS, et al. Elucidation of the metabolic fate of glucose in the filamentous fungus Trichoderma reesei using expressed sequence tag (EST) analysis and cDNA microarrays. J Biol Chem 277: 13983-13988, 2002. PubMed: 11825887

Rey M, et al. Unexpected homology between inducible cell wall protein QID74 of filamentous fungi and BR3 salivary protein of the insect Chironomus. Proc Natl Acad Sci USA 95: 6212-6216, 1998. PubMed: 9600944

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation