Tremella mesenterica Fries (ATCC® 24925)

Strain Designations: RJB 2259-6 [DSM 1558, NRRL Y-6157, UBC 559-6, CBS 8224, IFO 9311, NBRC 9311]  /  Product Format: frozen

Permits and Restrictions

View Permits

Strain Designations RJB 2259-6 [DSM 1558, NRRL Y-6157, UBC 559-6, CBS 8224, IFO 9311, NBRC 9311]
Application
Multigene phylogeny and phenotypic characterization.
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Genome Sequenced Strain

Yes

Mating Type aBII mating type aBII RefReid ID. Properties of conjugation hormones (erogens) from the basidiomycete. Can. J. Bot. 52: 521-524, 1974.
Comments
Genome sequencing strain (the Joint Genome Institute (JGI) at the Department of Energy, USA).
Multigene phylogeny and phenotypic characterization.
Medium ATCC® Medium 323: Malt agar medium
ATCC® Medium 336: Potato dextrose agar (PDA)
ATCC® Medium 597: Clavicorona medium
Growth Conditions
Temperature: 24°C to 26°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

AAGGATCAATGGAGATCGCCGAAAGGCATCACACGCACAGTGCACCCTTGCAGACATTTAGGTCGAGAACGTATGCATCTTAAAATGAAACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGGACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGTATTCAGTGAATCATCGAACCTTTGAACGCACCTTGCGCCCCTTGGAAATTCCGTCGGGCATGCCTGTCTGAGTGTCATGTGGACTTCGACCCCGAGGGTTATTCCCCCGGGGCCGGACTTGGGCGCCGCCTCACCCGGCCCGCCTCAAATGCATCAGCGGGACGCGACGTCATAAGCACCGTCCGTGTCCCGCCCACAGAACACCCATCTTGTAACTCTGACCTCAGATCAGGTAGGACTACCCGCTGAACTTAAG


D1D2 region of the 28S ribosomal RNA gene

CATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACGGCGAGCGAACCGGGAAGAGCTCAAATTTGAAATCTGGCGTCCCACGGGCGTCCGAGTTGTAATCTGCAGAGGCGTCTTCCGCCCCGGACCGCGTCCAAGTCCCTTGGAACAGGGTATCAAAGAGGGTGACAATCCCGTGCTTGACGCGACCCCCGGTGCTATGTGATGCGACCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAACGGGTGGTAAATTCCATCTAAGGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGGAAGGGAAACGATTGAAGTCAGTCGTGTCCGAGGGGTTCAGCCGGTCCTGCCGGTGCACTCCCCTCGGACGGGTCAACATCGGTTCTGTCCGGCGGACAAGGGCAGGGGGAACGTGGCACCCTCGTGGTGTGTTATAGCCCCCCGTCGCATACGTCGGTCGGGACCGAGGATCGCAGCTCGCCCTCACGGGCCGGGGTTCGCCCACGTCCGAGCTTAGGATGTTGACGTAATGGCTTTAAACGA

Name of Depositor RJ Bandoni
Isolation
Fallen Alnus rubra, Canada
Cross References

Nucleotide (GenBank) : AFVY00000000 Tremella mesenterica DSM 1558 strain Fries, whole genome shotgun sequencing project

References

Reid ID. Growth of Tremella mesenterica haplonts with various nitrogen sources. Can J Bot 53: 73-77, 1975.

Dupuis G, et al. Cinnamylphenols as inhibitors of fungal growth. Can. J. Microbiol. 18: 929-932, 1972. PubMed: 5034225

Reid ID. Properties of conjugation hormones (erogens) from the basidiomycete. Can. J. Bot. 52: 521-524, 1974.

Findley K, et al. Phylogeny and phenotypic characterization of pathogenic Cryptococcus species and closely related saprobic taxa in the Tremellales. Eukaryot Cell 8(3): 353-361, 2009. PubMed: 19151324

Floudas D, et al. The Paleozoic origin of enzymatic lignin decomposition reconstructed from 31 fungal genomes. Science 336: 1715-1719, 2012. PubMed: 22745431

Reid ID. Properties of conjugation hormones (erogens) from the basidiomycete. Can. J. Bot. 52: 521-524, 1974.

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation