Thermomyces ibadanensis Apinis et Eggins (ATCC® 22716)

Strain Designations: CBS 281.67 [BDUN 381, IMI 96473]  /  Product Format: frozen

Permits and Restrictions

View Permits

Strain Designations CBS 281.67 [BDUN 381, IMI 96473]
Biosafety Level 1
Product Format frozen
Type Strain yes (type strain)
Preceptrol® no
Genome Sequenced Strain

Yes

Comments
ATCC 22716 is the type strain of Thermomyces ibadanensis. However, its ITS region has identical sequence to that of many Thermomyces lanuginosus strains including ATCC 200065, the genome sequencing strain. Thus, the taxonomy of ATCC 22716 is not entirely clear. Further investigation is needed.
Medium ATCC® Medium 350: Emerson YpSs agar
Growth Conditions
Temperature: 37.0°C
Sequenced Data
ITS sequence includes the terminus of 18S rDNA, ITS1, 5.8SrDNA, ITS2, and the terminus of 28S rDNA.

AGGCTCTACTGATCGAGGTCACCTTGGAGATTGACCTTCAGAGGCTATGGCCCCGGCCGGACCCCTCCTTGAGCGCGTGACAGAGCCCCATACGCTCGAGGACCGGACGCGACGCCGCCGCTGCCTTTCAGGCCCGTCCCCTCCAAACGAGGGGACGGCGGCCCAACACACAAGCCGTGCTTGAGGGTTCGCAATGACGCTCGGACAGGCATGCCCCCCGGAATACCAGAGGGCGCAATGTGCGTTCAAAGATTCGATGATTCACGGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCCGGAACCAAGAGATCCATTGTTGAAAGTTTTGAACGATTGCATTTCGTCACTCAGACAATCCTCGCATTCACAAAAGCGTTCACAGTGAGTGCCTCTGGCGGGCACGGGCCCCGGGGGCACACCGCGCCCCGGGACGACCCCCCCGGCGGAACACCGGAGGAGTGGGCCCGCCAAAGCAACACTAGGTGTGGTAGACACGGGTGGGAGATTGGGACCCGACTGGGTTCCCGCACTCGGTAATGATCCTTCCGCAGGTTCACCCTACGGAAGATTCCGAGTGGGGTAACCCAGTCGGGTCCAATCTCCACCCGTGTCTACCACACCTAGTGTTGCTTGGCGGGCCACTCTTCCGTGTTCGCGGGGGGGTGTCCGGGGGGGGTGTGCCCCGGGGCCGTGCCGCAGAGGACTCACGGGAACGTTTTGTGAATGCAGGATGTTTGAGGACGAATGCATCGTCAGACTTTACCAATGGATCTTGCTTCGCATCGAGAAGAGCAGGATGCCATAGTATGGTGATGTAAATCATGATCACACCTTTGACGCCATTGCCTCGGTATTCGGGGCTGCTGATCGACCTTGTCGACACTACAGTGGGTGTGGTGGGACATATTATGAGCAGAGCTTGGAGACGACCTCGTCTCATGGGATAT

ATCC 22716 is the type strain of Thermomyces ibadanensis (see reference below). Its ITS region has identical sequence to that of many Thermomyces lanuginosus strains including ATCC 200065, the genome sequencing strain. Thus, the taxonomy of ATCC 22716 is not entirely clear. Further investigation of its taxonomic position is needed.

Name of Depositor CBS
Chain of Custody
ATCC <<--CBS<<--HOW Eggins BDUN 381
Isolation
Stored oil palm kernels, Nigeria
References

Apinis AE, Eggins HO. Thermomyce ibadanensis sp.nov. from oil palm kernel stacks in Nigeria. Trans. Br. Mycol. Soc. 49: 629-632, 1966.

type strain

type strain

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation