Trametes versicolor (Linnaeus : Fries) Lloyd (ATCC® 20869)

Strain Designations: PAP 52 [52J, 52P, BRIM 186, PRIC 52]  /  Product Format: frozen

Permits and Restrictions

View Permits

Deposited As Coriolus versicolor (Linnaeus) Fries
Strain Designations PAP 52 [52J, 52P, BRIM 186, PRIC 52]
Application
Produces cellobiose dehydrogenase
Produces laccase
Produces manganese peroxidase
Bleaches hardwood kraft pulp
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Disclosure This material is cited in a US or other Patent and may not be used to infringe the claims. Depending on the wishes of the Depositor, ATCC may be required to inform the Patent Depositor of the party to which the material was furnished. This material may not have been produced or characterized by ATCC.
Preceptrol® no
Genome Sequenced Strain

Yes

Comments
Genome sequencing strain (Concordia University, Canada).
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

AAGGATCATTAACGAGTTTTGAAACGAGTTGTAGCTGGCCTTCCGAGGCATGTGCACGCTCTGCTCATCCACTCTACCCCTGTGCACTTACTGTAGGTTGGCGTGGGCTCCTTAACGGGAGCATTCTGCCGGCCTATGTATACTACAAACACTTTAAAGTATCAGAATGTAAACGCGTCTAACGCATCTATAATACAACTTTTAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGGAATTCTCAACTTATAAATCCTTGTGATCTATAAGCTTGGACTTGGAGGCTTGCTGGCCCTTGCGGTCGGCTCCTCTTGAATGCATTAGCTCGATTCCGTACGGATCGGCTCTCAGTGTGATAATTGTCTACGCTGTGACCGTGAAGTGTTTTGGCGAGCTTCTAACCGTCCATTAGGACAACTTTTTAACATCTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATC


D1D2 region of the 28S ribosomal RNA gene

CATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCGGTCTTTGGCCGTCCGAGTTGTAGTCTGGAGAAGCGTCTTCCGCGTTGGACCGTGTACAAGTCTCTTGGAACAGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAATGCTTTGTGATGCGCTCTCAAAGAGTCGCGTTGTTTGGGAATGCAGCGCAAAATGGGAGGTGAATTCCTTCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTAAAAGGGAAACGCTTGAAGTCAGTCGCGTCGTCCGGAACTCAGCTTTGCTTCGGCTTAGTGCACTTTCCGGTTGACGGGCCAGCATCGATTTTGACCGCTGGAAAAGGGCTGGAGGAATGTGGCACCTTCGGGTGTGTTATAGCCTTCAGTCGCATACAGCGGTTGGGATCGAGGAACGCAGCGCGCCTTATGGCTGGGGTTCGCCCACATTCGCGCTTAGGATGCTGGCATAATGGCTTTAAACGACCCGTC

Name of Depositor Pulp and Paper Research Institute of Canada
U.S. Patent Number
Disclosure This material is cited in a US or other Patent and may not be used to infringe the claims. Depending on the wishes of the Depositor, ATCC may be required to inform the Patent Depositor of the party to which the material was furnished. This material may not have been produced or characterized by ATCC.
Isolation
Rotting elm stump
Cross References

Nucleotide (GenBank) : AF029668 cellobiose dehydrogenase (cdh) gene, complete coding sequence

References

Kirkpatrick N, et al. Biological bleaching of hardwood kraft pulp using Trametes (Coriolus) versicolor immobilized in polyurethane foam. Appl. Microbiol. Biotechnol. 33: 105-108, 1990.

Archibald FS, et al. Direct biological bleaching of hardwood kraft pulp with the fungus Coriolus versicolor. US Patent 4,830,708 dated May 16 1989

Paice MG, et al. Manganese peroxidase, produced by Trametes versicolor during pulp bleaching, demethylates and delignifies kraft pulp. Appl. Environ. Microbiol. 59: 260-265, 1993.

Addleman K, Archibald F. Kraft pulp bleaching and delignification by dikaryons and monokaryons of Trametes versicolor. Appl. Environ. Microbiol. 59: 266-273, 1993.

Bourbonnais R, Paice MG. Oxidation of non-phenolic substrates. An expanded role for laccase in lignin biodegradation. FEBS Lett. 267: 99-102, 1990. PubMed: 2365094

Archibald F, Roy B. Production of manganic chelates by laccase from the lignin-degrading fungus Trametes (Coriolus) versicolor. Appl. Environ. Microbiol. 58: 1496-1499, 1992. PubMed: 1622216

Reid ID, Paice MG. Effect of residual lignin type and amount on bleaching of kraft pulp of Trametes versicolor. Appl. Environ. Microbiol. 60: 1395-1400, 1994.

Dumonceaux TJ, et al. Cloning and sequencing of a gene encoding cellobiose dehydrogenase from Trametes versicolor. Gene 210: 211-219, 1998. PubMed: 9573367

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • USDA APHIS PPQ Permit 526, plant pathogens permit must be obtained and a copy of the permit must be sent to ATCC in advance of shipment. Isolation information for this item is required by USDA. Please check our website or contact Technical Service for assistance. Domestic isolates are easier to obtain than foreign isolates.
  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation