Rhodosporidium toruloides Banno (ATCC® 204091)

Strain Designations: IIP 30 [MTCC 1151]  /  Product Format: frozen

Deposited As Rhodotorula glutinis (Fresenius) Harrison
Strain Designations IIP 30 [MTCC 1151]
Application
produces lipids
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Genome Sequenced Strain

Yes

Comments Genome sequencing strain (Mississippi State University, USA)
Medium ATCC® Medium 1245: YEPD
ATCC® Medium 200: YM agar or YM broth
ATCC® Medium 28: Emmons' modification of Sabouraud's agar
Growth Conditions
Temperature: 25°C to 30°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

GGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAGTGAATATTAGGGTGTCCAACTTAACTTGGAGCCCGACCCTCACTTTCTAACCCTGTGCATTTGTCTTGGGTAGTAGCTCGCGTCAGCGAGCGAATCCCATTTCACTTACAAACACAAAGTCTATGAATGTAACAAATTTATAACAAACAAAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCATGGTATTCCGTGGAGCATGCCTGTTTGAGTGTCATGAATTCTTCAACCCACCTCTTTCTTAGTGAATCAGGCGGTGTTTGGATTCTGAGCGTTGCTGGCTTCGCGGCCTAGCTCGCTCGTAATGCATTAGCATCCGCAATCGAACTTCGGATTGACTCGGCGTAATAGACTATTCGCTGAGGATTCTGGTCTCTGACTGGAGCCGGGTAAGATTAAAGGAAGCTACCAATCCTCATGTCTATCTTTTGAGATTAGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAA


D1D2 region of the 26S ribosomal RNA gene

ATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAGCGGCGAGCGAAGCGGGAAGAGCTCAAATTTGTAATCTGGCACCTTCGGTGTCCGAGTTGTAATCTCTAGAAGTGTTTTCCGCGTTGGACCGCACACAAGTCTGTTGGAATACAGCGGCATAGTGGTGATACCCCATTACACGGTGCGGACGCCCAGCGCTTTGTGATACACTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAATTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAGTACGTGAAATTGTTGGAAGGGAAACGCTTGAAGTCAGACTTGCTTGCCGGGCTTGCTCGGTTTGCAGGCCAGCATCAGTTTTCTGGGACGGATAATGGCAGTTAGAATGTAGCAGTCTCGGCTGTGTTATAGCTTTCTGCTGGATACGTCCTGGGGGACTGAGGAACGCAGCGTGCCGTATGGCGAGGGCTTTGGTCCTTTCACGCTTAGGATGCTGGTGGAATGGCTTTAAACGAC

Name of Depositor NK Yadav
Chain of Custody
ATCC <-- NK Yadav <-- VW Johnson
Isolation
Soil, Baroda, India
References

Pathak R, Yadav NK. Influence of cultural conditions on lipid production by mutant strain of Rhodotorula glutinis MTCC 1151. Indian J. Exp. Biol. 35: 366-368, 1997. PubMed: 9315236

N K Yadav, personal communication

Yu X, et al. Oil production by oleaginous yeasts using the hydrolysate from pretreatment of wheat straw with dilute sulfuric acid. Bioresour. Technol. 102: 6134-6140, 2011. PubMed: 21463940

Koh CM, et al. Molecular characterization of KU70 and KU80 homologues and exploitation of a KU70-deficient mutant for improving gene deletion frequency in Rhodosporidium toruloides. BMC Microbiol 14: 50, 2014. PubMed: 25188820

Liu Y, et al. Characterization of glyceraldehyde-3-phosphate dehydrogenase gene RtGPD1 and development of genetic transformation method by dominant selection in oleaginous yeast Rhodosporidium toruloides. Appl. Microbiol. Biotechnol. 97: 719-729, 2013. PubMed: 22722909