Kluyveromyces marxianus (EC Hansen) van der Walt (ATCC® 200963)

Alternate State: Candida kefyr (Beijerinck) van Uden et Buckley, anamorph  /  Strain Designations: HA 63 [NRRL Y-8281, CBS 712]  /  Product Format: frozen

Permits and Restrictions

View Permits

Deposited As Kluyveromyces marxianus (Hansen) van der Walt
Strain Designations HA 63 [NRRL Y-8281, CBS 712]
Alternate State Candida kefyr (Beijerinck) van Uden et Buckley, anamorph
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain yes
Preceptrol® no
Genome Sequenced Strain

Yes

Comments
RAPD profiles
Genome sequencing strain (Genolevures Consortium, France).
Medium ATCC® Medium 200: YM agar or YM broth
Growth Conditions
Temperature: 24°C to 26°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

AAGGATCATTAAAGATTATGAATGAATAGATTACTGGGGGAATCGTCTGAACAAGGCCTGCGCTTAATTGCGCGGCCAGTTCTTGATTCTCTGCTATCAGTTTTCTATTTCTCATCCTAAACACAATGGAGTTTTTTCTCTATGAACTACTTCCCTGGAGAGCTCGTCTCTCCAGTGGACATAAACACAAACAATATTTTGTATTATGAAAAACTATTATACTATAAAATTTAATATTCAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAATTGCGATATGTATTGTGAATTGCAGATTTTCGTGAATCATCAAATCTTTGAACGCACATTGCGCCCTCTGGTATTCCAGGGGGCATGCCTGTTTGAGCGTCATTTCTCTCTCAAACCTTTGGGTTTGGTAGTGAGTGATACTCGTCTCGGGTTAACTTGAAAGTGGCTAGCCGTTGCCATCTGCGTGAGCAGGGCTGCGTGTCAAGTCTATGGACTCGACTCTTGCACATCTACGTCTTAGGTTTGCGCCAATTCGTGGTAAGCTTGGGTCATAGAGACTCATAGGTGTTATAAAGACTCGCTGGTGTTTGTCTCCTTGAGGCATACGGCTTTAACCAAAACTCTCAAAGTTTGACCTCAAATCAGGTAGGAGTACCCGCTGAACTTAAGCATATC


D1D2 region of the 28S ribosomal RNA gene

AATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCGTCTTCGACGTCCGAGTTGTAATTTGAAGAAGGCGACTTTGTAGCTGGTCCTTGTCTATGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTGTGGCGAGGATCCCAGTTATTTGTAAAGTGCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCATTTGATCAGACATGGCGTTTGCTTCGGCTTTCGCTGGGCCAGCATCAGTTTTAGCGGTTGGATAAATCCTCGGGAATGTGGCTCTGCTTCGGTAGAGTGTTATAGCCCGTGGGAATACAGCCAGCTGGGACTGAGGATTGCGACTTTTGTCAAGGATGCTGGCGTAATGGTTAAATGCCGCCCGTC

Name of Depositor H Prillinger
References

Molnar O, et al. Analysis of coenzyme Q systems, monosaccharide patterns of purified cell walls, and RAPD-PCR patterns in the genus Kluyveromyces. Antonie van Leeuwenhoek 70: 67-78, 1996. PubMed: 8836443

van der Walt JP. New combinations in the genera Brettanomyces, Kluyveromyces, Lodderomyces and Wingea. Bothalia 10: 417-418, 1971.

Souciet JL, et al. Genomic Exploration of the Hemiascomycetous Yeasts: 1. A set of yeast species for molecular evolution studies. FEBS Lett. 487: 3-12, 2000.

Llorente B, et al. Genomic Exploration of the Hemiascomycetous Yeasts: 12. Kluyveromyces marxianus var. marxianus. FEBS Lett. 487: 71-75, 2000.

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation