Thermomyces lanuginosus Tsiklinsky, anamorph (ATCC® 200065)

Strain Designations: 1457  /  Product Format: freeze-dried

Permits and Restrictions

View Permits

Deposited As Thermomyces lanuginosus Tsiklinsky
Strain Designations 1457
Application
produces amylase, alpha 1A; salivary Amylase, salivary, alpha-1A
produces glucoamylase
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Genome Sequenced Strain

Yes

Comments
Growth kinetics
Thermotolerance
Genome sequencing strain (Concordia University, Canada).
Medium ATCC® Medium 350: Emerson YpSs agar
Growth Conditions
Temperature: 50°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

AAGGATCATTACCGAGTGCGGGAACCCAGTCGGGTCCCAATCTCCCACCCGTGTCTACCACACCTAGTGTTGCTTTGGCGGGCCCACTCCTCCGGTGTTCCGCCGGGGGGGTCGTCCCGGGGCGCGGTGTGCCCCCGGGGCCCGTGCCCGCCAGAGGCACTCACTGTGAACGCTTTTGTGAATGCGAGGATTGTCTGAGTGACGAAATGCAATCGTTCAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCGAACCCTCAAGCACGGCTTGTGTGTTGGGCCGCCGTCCCCTCGTTTGGAGGGGACGGGCCTGAAAGGCAGCGGCGGCGTCGCGTCCGGTCCTCGAGCGTATGGGGCTCTGTCACGCGCTCAAGGAGGGGTCCGGCCGGGGCCATAGCCTCTGAAGGTCAATTCTTCCAAGGTTGACCTCGGATCAGGTAGGAGTACCCGCTGAACTTAAG


D1D2 region of the 28S ribosomal RNA gene

CATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAAGAGCTCAAATTTGAAATCTGGCTCCTTCGGGAGTCCGAGTTGTAATTTGGAGAGGATGCTTCGGGTATGGCCCCCGTCTAAGTGCCCTGGAACGGGCCGTCGGAGAGGGTGAGAACCCCGTCTGGGATGGGAGGCCAGGCCCGTGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTTCATCTAAAGCTAAATACTGGCCGGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCGGTCAGACTCGCTCCGGGGGGCTCCGTCGGCACTCGTTGCCGGCGTACTCCCTCCCGGGGCGGGCCAGCATCAGCTCTGGCGGCCGGTGAAAGGTTCCCGGAAGGTAGCACCCTCCGGGGTGTCTTATAGCCGGGGACGGAATACGGCCAGCCGGGGCTGAGGAACGCGCTTCGGCTCGGATGCTGGCGTAATGGCCGTAAGCGA

Name of Depositor B Jensen
Special Collection NCRR Contract
Chain of Custody
ATCC <-- B Jensen <-- J. Koch
Isolation
Peak-heated compost mushroom, Denmark; single-spore isolate.
References

. . Appl. Microbiol. Biotechnol. 34: 656-660, 1991.

Jensen B, et al. Growth kinetics of the thermophilic fungus Thermomyces lanuginosus. Mycol. Res. 97: 665-669, 1993.

. . Enzyme Microb. Technol. 14: 112-116, 1992.

Trent JD, et al. Acquired thermotolerance and heat shock proteins in thermophiles from the three phylogenetic domains. J. Bacteriol. 176: 6148-6152, 1994. PubMed: 7928981

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation