Aspergillus flavus Link (ATCC® 200026)

Strain Designations: NRRL 3357 [M52, CBS 128202]  /  Product Format: freeze-dried

Strain Designations NRRL 3357 [M52, CBS 128202]
Application
Produces aflatoxin B1 aflatoxin B
Produces aflatoxin B2
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Genome Sequenced Strain

Yes

Comments
Genome sequencing strain (J. Craig Venter Institute, USA; Joint Genome Institute, Department of Energy, USA).
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

GTTTCCGTAGGTGAACCTGCGGAAGGATCATTACCGAGTGTAGGGTTCCTAGCGAGCCCAACCTCCCACCCGTGTTTACTGTACCTTAGTTGCTTCGGCGGGCCCGCCATTCATGGCCGCCGGGGGCTCTCAGCCCCGGGCCCGCGCCCGCCGGAGACACCACGAACTCTGTCTGATCTAGTGAAGTCTGAGTTGATTGTATCGCAATCAGTTAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAACTAGTGTGAATTGCAGAATTCCGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCATCAAGCACGGCTTGTGTGTTGGGTCGTCGTCCCCTCTCCGGGGGGGACGGGCCCCAAAGGCAGCGGCGGCACCGCGTCCGATCCTCGAGCGTATGGGGCTTTGTCACCCGCTCTGTAGGCCCGGCCGGCGCTTGCCGAACGCAAATCAATCTTTTTCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAG


D1D2 region of the 28S ribosomal RNA gene

CATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAAGAGCTCAAATTTGAAAGCTGGCTCCTTCGGGGTCCGCATTGTAATTTGCAGAGGATGCTTCGGGTGCGGCCCCTGTCTAAGTGCCCTGGAACGGGCCGTCAGAGAGGGTGAGAATCCCGTCTGGGATGGGGTGTCCGCGCCCGTGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATACTGGCCGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCGACCAGACTCGCCTCCAGGGTTCAGCCGGCATTCGTGCCGGTGTACTTCCCTGGGGGCGGGCCAGCGTCGGTTTGGGCGGCCGGTCAAAGGCTCCCGGAATGTAGTGCCCTCCGGGGCACCTTATAGCCGGGAGTGCAATGCGGCCAGCCTGGACCGAGGAACGCGCTTCGGCACGGACGCTGGCATAATGGTCGTAAACGAC

Name of Depositor NRRL
Special Collection NCRR Contract
Chain of Custody
ATCC <-- NRRL <-- FA Hodges M52
Isolation
Peanut cotyledons, USA
Cross References

Nucleotide (GenBank) : AAIH00000000 Aspergillus flavus NRRL3357, whole genome shotgun sequencing project

Nucleotide (GenBank) : JX535495 ITS including 5.8S rRNA gene

Nucleotide (GenBank) : JX535498 D1/D2 region of 28S rRNA gene

References

Norton RA. A novel glass fiber disc culture system for testing of small amounts of compounds on growth and aflatoxin production by Aspergillus flavus. Mycopathologia 129: 103-109, 1995. PubMed: 7659139

Yu J, et al. Aspergillus flavus expressed sequence tags for identification of genes with putative roles in aflatoxin contamination of crops. FEMS Microbiol. Lett. 237: 333-340, 2004.

Wang H, et al. A fungal phylogeny based on 82 complete genomes using the composition vector method. BMC Evol. Biol. 9: 195, 2009. PubMed: 19664262

Kuprys PV, et al. Identification of telomerase RNAs from filamentous fungi reveals conservation with vertebrates and yeasts. PLoS One 8: e58661, 2013. PubMed: 23555591

Joardar V, et al. Sequencing of mitochondrial genomes of nine Aspergillus and Penicillium species identifies mobile introns and accessory genes as main sources of genome size variability. BMC Genomics 13: 698, 2012. PubMed: 23234273

Fekete E, et al. Identification of a permease gene involved in lactose utilisation in Aspergillus nidulans. Fungal Genet Biol 49: 415-425, 2012. PubMed: 22445777

Glenn AE, et al. Comparative genomic and phylogenetic investigation of the xenobiotic metabolizing arylamine N-acetyltransferase enzyme family. FEBS Lett 584: 3158-3164, 2010. PubMed: 20621844

Nicholson MJ, et al. Identification of two aflatrem biosynthesis gene loci in Aspergillus flavus and metabolic engineering of Penicillium paxilli to elucidate their function. Appl Environ Microbiol 75: 7469-7481, 2009. PubMed: 19801473

Kim JH, et al. Examination of fungal stress response genes using Saccharomyces cerevisiae as a model system: targeting genes affecting aflatoxin biosynthesis by Aspergillus flavus Link. Appl Microbiol Biotechnol 67: 807-815, 2005. PubMed: 15614562