Trichoderma longibrachiatum Rifai (ATCC® 18648)

Strain Designations: 13423 [4576, CBS 816.68]  /  Product Format: freeze-dried

Permits and Restrictions

View Permits

Strain Designations 13423 [4576, CBS 816.68]
Application
Produces alpha-aminoisobutyric acid
Produces leucinol
Produces paracelsin
Produces phenylalaninol
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain yes
Preceptrol® no
Genome Sequenced Strain

Yes

Comments
Taxonomy

Genome sequencing strain (The Joint Genome Institute at the Department of Energy, USA)

Medium ATCC® Medium 200: YM agar or YM broth
ATCC® Medium 340: Rabbit food agar
ATCC® Medium 336: Potato dextrose agar (PDA)
Growth Conditions
Temperature: 24°C to 26°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

GGTCTCCGTTGGTGAACCAGCGGAGGGATCATTACCGAGTTTACAACTCCCAAACCCCAATGTGAACGTTACCAATCTGTTGCCTCGGCGGGATTCTCTTGCCCCGGGCGCGTCGCAGCCCCGGATCCCATGGCGCCCGCCGGAGGACCAACTCCAAACTCTTTTTTTCTCTCCGTCGCGGCTCCCGTCGCGGCTCTGTTTTATTTTTGCTCTGAGCCTTTCTCGGCGACCCTAGCGGGCGTCTCGAAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTCCGAGCGTCATTTCAACCCTCGAACCCCTCCGGGGGGTCGGCGTTGGGGATCGGCCCCTCACCGGGCCGCCCCCGAAATACAGTGGCGGTCTCGCCGCAGCCTCTCCTGCGCAGTAGTTTGCACACTCGCACCGGGAGCGCGGCGCGGCCACAGCCGTAAAACACCCCAAACTTCTGAAATGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAA


D1D2 region of the 28S ribosomal RNA gene

ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCTTACGGGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGCAAGGCGCCGCCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTCTGGCTGGCCGCCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTATATGTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGAGGGTTAAATAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGGGCGCGGCGGATCATCCGGGGTTCTCCCCGGTGCACTTCGCCGCGTCCAGGCCAGCATCAGTTCGTCGCGGGGGAAAAAGGCTTCGGGAACGTGGCTCCCTCGGGAGTGTTATAGCCCGTTGCGTAATACCCTGCGGTGGACTGAGGACCGCGCATCTGCAAGGATGCTGGCGTAATGGTCACCAGCGAC


beta tubulin gene

CTATCTCTTCGTTCCCCCCCTCTTCGTTGTTCACTTTGGGTTACTCTCGCAACGCGTTTGGCGATTGGAGCCCCTGAAATTGTACCCCGCCAAAGTCAACGAAACGAACACTTTGGCGTTTTCCCGCCCGAATGAAGGCCCAATTCTGCTCGATCGAGGCGTTTTGTGATGCTGTGCGGATGACATTTGCTAATTGCTGAGTTTCTTTGCGATGAATAGGTTCACATCCAGACCGGCCAGTGCGTAAGTCACTTCTTCCCTTAACGATTCGCCCCCGCTGAATCCTGCGGACGGGAGCTTACAATCCTCGACAGGGTAACCAAATCGGTGCCGCCTTTTGGCAGACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGTATCTACGGCGGCTCTTCCGAGCTCCAGCTGGAGCGCATGAACGTCTATTTCAACGAGGTACGCGCTTTTCCCCCTCGCTGATAGCGTTTACGGCTTGCTAGATGAGCACTCTGGGAGGGGGCCCCTATTCTAACTTCAGGTGGTGCAGGCCAACAACAACAAGTACGTTCCTCGCGCTGTCCTCGTCGATCTCGAGCCCGGTACTATGGACGCCGTCCGTGCCGGTCCCTTCGGTCAGCTCTTCCGACCCGACAACTTCATCTTCGGCCAGTCCAGTGCCGGCAACAACTGG

Name of Depositor C Dennis
Chain of Custody
ATCC <-- C Dennis <-- WB Cooke 4576
Isolation
Mud, Ohio
Cross References

Nucleotide (GenBank) : Z31019 internal transcribed spacers, ITS-1 and ITS-2 and the 5.8S ribosomal DNA, sequences

References

Rifai MA. A revision of the genus Trichoderma. Commonw. Mycol. Inst. Mycol. Pap. 116: 1-56, 1969.

Solfrizzo M, et al. Detection of peptaibols and their hydrolysis products in cultures of Trichoderma species. Nat. Toxins 2: 360-365, 1994. PubMed: 7704449

Turner D, et al. Biogeography and phenotypic variation in Trichoderma sect. Longibrachiatum and associated Hypocrea species. Mycol. Res. 101: 449-459, 1997.

Ospina-Giraldo MD, et al. Phylogenetic relationships of Trichoderma harzianum causing mushroom green mold in Europe and North America to other species of Trichoderma from world-wide sources. Mycologia 90: 76-81, 1998.

Kim CS, et al. Trichoderma eijii and T. pseudolacteum, two new species from Japan. Mycol Prog 12: 739-753, 2013.

Samuels GJ, Ismaiel A. Hypocrea peltata: a mycological Dr Jekyll and Mr Hyde? Mycologia 103: 616-630, 2011. PubMed: 21262986

Ihrmark K, et al. Comparative molecular evolution of Trichoderma chitinases in response to mycoparasitic interactions. Evol Bioinform Online 6: 1-26, 2010. PubMed: 20454524

Druzhinina IS, et al. Alternative reproductive strategies of Hypocrea orientalis and genetically close but clonal Trichoderma longibrachiatum, both capable of causing invasive mycoses of humans. Microbiology 154: 3447-3459, 2008. PubMed: 18957598

Samuels GJ. Trichoderma: systematics, the sexual state, and ecology. Phytopathology 96: 195-206, 2006. PubMed: 18943925

Druzhinina IS, et al. An oligonucleotide barcode for species identification in Trichoderma and Hypocrea. Fungal Genet Biol 42: 813-828, 2005. PubMed: 16154784

Jaklitsch WM, et al. Hypocrea voglmayrii sp. nov. from the Austrian Alps represents a new phylogenetic clade in Hypocrea/Trichoderma. Mycologia 97: 1365-1378, 2005. PubMed: 16722227

Kullnig-Gradinger CM, Szakacs G, Kubicek CP. Phylogeny and evolution of the genus Trichoderma: a multigene approach. Mycol Res 106: 757-767, 2002.

Lee C-F, Hseu T-H. Genetic relatedness of Trichoderma sect. Pachybasium species based on molecular approaches. Can J Microbiol 48: 831-840, 2002. PubMed: 12455615

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation