Penicillium marneffei Segretain et al. (ATCC® 18224)

Strain Designations: QM 7333 [CBS 334.59, IMI 68794, LSHB BB361]  /  Product Format: freeze-dried

Permits and Restrictions

View Permits

Deposited As Penicillium marneffei Segretain et al., anamorph
Strain Designations QM 7333 [CBS 334.59, IMI 68794, LSHB BB361]
Application
Biomedical Research and Development Material
Emerging infectious disease research
Biosafety Level 2

Biosafety  classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format freeze-dried
Type Strain yes (. The genus Penicillium. London: Academic Press; 1979.), RefSegretain G. Description d'une nouvelle espece de Penicillium: Penicillium marneffei n. sp.. Bull. Soc. Mycol. Fr. 75: 412-416, 1959. , Ref. . Bull. Soc. Pathol. Exot. 49: 418-421, 1956.
Preceptrol® no
Genome Sequenced Strain

Yes

Comments
fluorescent antibody test
Genome sequencing strain (J. Craig Venter Institute, USA).
Medium ATCC® Medium 325: Malt extract agar (Blakeslee's formula)
Growth Conditions
Temperature: 24.0°C
Sequenced Data
       18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.

AATATGGTGGTGACCAACCCCCGCAGGTCCTTCCCGAGCGAGTGACAGAGCCCCATACGCTCGAGGACCAGACGGACGTCGCCGCTGCCTTTCGGGCAGGTCCCCGGAGGGACCACACCCAACACACAAGCCGTGCTTGAGGGCAGAAATGACGCTCGGACAGGCATGCCCCCCGGAATGCCAGGGGGCGCAATGTGCGTTCAAAGATTCGATGATTCACGGAATTCTGCAATTCACATTACTTATCGCA

TTTCGCTGCGTTCTTCATCGATGCCGGAACCAAGAGATCCATTGTTGAAAGTTTTGACAATTTTCATGGTACTCAGACAGTCCATCTTCATCAGGGTTCACAGGGCGCTTCGGCGGGCGCGGGCCCGGGGACAAACGTCCCCCGGCGACCGGGTGGCCCCGGTGGGCCCGCCAAAGCAACAGGTGTATAGAGACAAGGGTGGGAGGTTGGGCCGCGAGGGCCCGCACTCGGTAATGATCCTTCCGCAGGT

TCACCTACGGAAACCTTGTTACGACTTTTACTTCCTCTAAATGACCAAGTTTGACCAACTTTCCGGCTCTGAGCGGTCGTTGCCAACCCCTCTGAGCCAGTCCGAAGGCCTCACTGAGCCATTCAATCGGTAGTAGCGACGGGCGGTGTGTACAAAGGGCA

Name of Depositor QM
Chain of Custody
ATCC <<--QM<<--L. Ajello <<--- G. Segretain <<--- Capponi et Sureau
Isolation
bamboo rat, Rhizomys sinensis, Vietnam
Cross References

Nucleotide (GenBank) : L37406 Penicillium marneffei transcribed spacers 1 and 2 and 5.8S

Nucleotide (GenBank) : L37407 Penicillium marneffei mitochondrial small subunit ribosomal RNA

Complete Genome (GenBank) : ABAR01000000 Penicillium marneffei ATCC 18224, whole genome shotgun sequencing project.

Nucleotide (GenBank) : JQ354997 Penicillium marneffei strain ATCC 18224 mitochondrial sequence

References

. The genus Penicillium. London: Academic Press; 1979.

Segretain G. Description d'une nouvelle espece de Penicillium: Penicillium marneffei n. sp.. Bull. Soc. Mycol. Fr. 75: 412-416, 1959.

. . Bull. Soc. Pathol. Exot. 49: 418-421, 1956.

Kaufman L, et al. Development of specific fluorescent-antibody test for tissue form of Penicillium marneffei. J. Clin. Microbiol. 33: 2136-2138, 1995. PubMed: 7559962

. The genus Penicillium. London: Academic Press; 1979.

Segretain G. Description d'une nouvelle espece de Penicillium: Penicillium marneffei n. sp.. Bull. Soc. Mycol. Fr. 75: 412-416, 1959.

. . Bull. Soc. Pathol. Exot. 49: 418-421, 1956.

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation