Mucor circinelloides f. lusitanicus Schipper, teleomorph (ATCC® 1216B)

Strain Designations: [CBS 277.49, NRRL 3631]  /  Product Format: freeze-dried

Permits and Restrictions

View Permits

Deposited As Mucor racemosus Fresenius, teleomorph
Strain Designations [CBS 277.49, NRRL 3631]
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format freeze-dried
Type Strain no
Preceptrol® no
Genome Sequenced Strain

Yes

Mating Type mating type minus
Comments
Translation rate
beta-Glucosidase synthesis
Dimorphism
Lipid synthesis
RNA synthesis
Mitochondrial genome
Construction of partial genomic libraries
Genome sequencing strain (the Joint Genome Institute at the Department of Energy, USA).
Morphology

After 7 days at 25°C colony up to 13 mm in height, light gray; sporangiophores up to 6 (10) µm in diam., sympodially branched; sporangia at first pale yellowish then brownish black to black, up to 60 µm in diam., leaving small collars; columellae obovoid to globose, mouse-grey, up to 38 x 35 µm, infrequently larger; sporangiospores rather irregular in size and shape, ellipsoidal, a few globose, 4.4-6.1 (8) x 3.8-4.4 µm, chlamydospores and oidia in submerged mycelium; submerged mycelium containing yellow droplets..

Medium ATCC® Medium 336: Potato dextrose agar (PDA)
Growth Conditions
Temperature: 24.0°C
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal   transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.

GATCAAATTTAAAAAAGTGTTATTTGGGAGGCCCCAGCACAGTTTACCGCAAGAGCTTCTCTTTATATTAAAAAAAAGTTCAGGCATCAAACAAGATCAGGCCTTTGTACATTTCAAGAGGTTGAGATCTGACGATCAAGAGACTCTCAGTCATCCTATTCAACAAAAGTTGGATAGAGGGTTTGTTTTGATACTGAAACAGGCGTGCTCATTGGAATACCAATGAGCGCAAGTTGCGTTCAAAGACTCGTGATTCACTGAATATGCAATTCACACTAGTTATCGCACTTTGCTACGTTCTTCATCGATGCGAGAACCAAGAGATCCGTTGTTAAAAGTTGTTTTATAGATTTTTTACGTCTATGTTACAATATTAATCTGAATTCTTTTGGTAAATAATAATAGGATACCAAGCCTAAGCTTGATTATGACTCGGTTAACATTTCCGCTGCCTATCCTTATAGCARTGGAACATCCCTCAGGCGTCAAGTAATAATACGTTTCCAGTAAATAGATAATGATGGACAAGCCAAAA

Morphology

After 7 days at 25°C colony up to 13 mm in height, light gray; sporangiophores up to 6 (10) µm in diam., sympodially branched; sporangia at first pale yellowish then brownish black to black, up to 60 µm in diam., leaving small collars; columellae obovoid to globose, mouse-grey, up to 38 x 35 µm, infrequently larger; sporangiospores rather irregular in size and shape, ellipsoidal, a few globose, 4.4-6.1 (8) x 3.8-4.4 µm, chlamydospores and oidia in submerged mycelium; submerged mycelium containing yellow droplets..

Name of Depositor AF Blakeslee
Cross References

Nucleotide (GenBank) : M26190 M.racemosus (Zygomycetes) 25S ribosomal RNA gene.

Nucleotide (GenBank) : X15582 Mucor racemosus RPG19 gene for ribosomal protein.

Nucleotide (GenBank) : X17475 Mucor racemosus TEF-3 gene for elongation factor 1-alpha

Nucleotide (GenBank) : X17476 Mucor racemosus TEF-2 gene for elongation factor 1-alpha

Nucleotide (GenBank) : J02605 M.racemosus TEF-1 gene encoding elongation factor 1-alpha

Nucleotide (GenBank) : M16353 M.racemosus elongation factor 1-alpha (TEF-2) gene, 3' end.

Nucleotide (GenBank) : M16354 M.racemosus elongation factor 1-alpha (TEF-3) gene, 3' end.

Nucleotide (GenBank) : M20232 M.racemosus elongation factor 1-alpha (TEF-2) gene, 5' end.

Nucleotide (GenBank) : M20233 M.racemosus elongation factor 1-alpha (TEF-3) gene, 5' end.

Nucleotide (GenBank) : U07696 Rhizomucor circinelloides f. lusitanicus ATCC 1216b putative

Nucleotide (GenBank) : AJ278321 Mucor racemosus partial gpd gene for glyceraldehyde-3-phosphate

References

Mukhtar M, et al. A procedure to construct partial genomic libraries for gene cloning from fungi. BioTechniques 17: 640-642, 1994. PubMed: 7833015

Orlowski M, Sypherd PS. Regulation of translation rate during morphogenesis in the fungus Mucor. Biochemistry 17: 569-575, 1978. PubMed: 623731

Schramke ML, Orlowski M. Mitochondrial genome of the dimorphic zygomycete Mucor racemosus. Curr. Genet. 24: 337-343, 1993. PubMed: 8252644

Orlowski M, Sypherd PS. RNA synthesis during morphogenesis of the fungus Mucor racemosus. Arch. Microbiol. 119: 145-152, 1978. PubMed: 727853

Borgia P, Sypherd PS. Control of beta-glucosidase synthesis in Mucor racemosus. J. Bacteriol. 130: 812-817, 1977. PubMed: 233721

Ito ET, et al. Lipid synthesis during morphogenesis of Mucor racemosus. J. Bacteriol. 152: 880-887, 1982. PubMed: 7130131

Inderlied CB, Sypherd PS. Glucose metabolism and dimorphism in Mucor. J. Bacteriol. 133: 1282-1286, 1978. PubMed: 641009

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation