Penicillium aculeatum Raper et Fennell (ATCC® 10409)

Strain Designations: NRRL 2129 [CBS 289.48, E-239, IMI 40588, NRRL A-1474, QM 3074]  /  Product Format: freeze-dried

Permits and Restrictions

View Permits

Strain Designations NRRL 2129 [CBS 289.48, E-239, IMI 40588, NRRL A-1474, QM 3074]
Application Produces dextranase
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain yes
Preceptrol® no
Comments Genome sequencing strain (the Joint Genome Institute at the Department of Energy, USA)
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

AAGGATCATTACCGAGTGCGGGCCCTCGCGGCCCAACCTCCCACCCTTGTCTCTATACACCTGTTGCTTTGGCGGGCCCACCGGGGCCACCTGGTCGCCGGGGGACGCACGTCCCCGGGCCCGCGCCCGCCGAAGCGCTCTGTGAACCCTGATGAAGATGGGCTGTCTGAGTAGTATGAAAATTGTCAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGCATTCCGGGGGGCATGCCTGTCCGAGCGTCATTTCTGCCCTCAAGCACGGCTTGTGTGTTGGGTGCGGTCCCCCCGGGGACCTGCCCGAAAGGCAGCGGCGACGTCCGTCTGGTCCTCGAGCGTATGGGGCTTTGTCACTCGCTCGGGAAGGACCTGCGGGGGTTGGTCACCACCACATTTTACCACGGTTGACCTCGGATCAGGTAGGAGTTACCCGCTGAACTTAAG


D1D2 region of the 28S ribosomal RNA gene

CATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAAGAGCTCAAATTTGAAATCTGGCCCCTTTGGGGTCCGAGTTGTAATTTGCAGAGGATGCTTCGGGTGCGGTCCCCGTCTAAGTGCCCTGGAACGGGCCGTCATAGAGGGTGAGAATCCCGTCTGGGATGGGCGGCCGCGCCCGTGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGCGGGTGGTAAATTTCATCTAAAGCTAAATACTGGCCGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGCACGTGAAATTGTTGAAAGGGAAGCGTTGTCCACCAGACTCGCCCGGGGGGGTTCAGCCGGCACGTGTGCCGGTGTACTCCTCTCCGGGCGGGCCAGCATCGGTTTGGGCGGCTGGTGAAAGGCCCCGGGAATGTAACACCCTCCGGGGTGCCTTATAGCCCGGGGTGCCATACAGCCAGCCTGGACCGAGGCCCGCGCTTCGGCGAGGATGCTGGCGTAATGGTGGTCAACGG

Name of Depositor NRRL
Chain of Custody
ATCC <-- NRRL <-- WH Weston E-239
Isolation Textiles, Florida
References

Viccaro JP, Weaver JM. Method of producing dextranase. US Patent 3,663,371 dated May 16 1972

Lopez-Villavicencio M, et al. Sex in Penicillium: combined phylogenetic and experimental approaches. Fungal Genet. Biol. 47: 693-706, 2010. PubMed: 20460164

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation