Cryptococcus neoformans (Sanfelice) Vuillemin (ATCC® MYA-4567)

Alternate State: Filobasidiella neoformans Kwon-Chung  /  Strain Designations: WM629 [CBS 10079]  /  Product Format: frozen

Strain Designations WM629 [CBS 10079]
Alternate State Filobasidiella neoformans Kwon-Chung
Application
Emerging infectious disease research
Biomedical Research and Development Material
Biosafety Level 2

Biosafety  classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Antigenic Properties Serotype D
Genotype VNIV, AFLP2
Preceptrol® no
Mating Type MATalpha
Comments
Reference strain of VN IV, AFLP2 molecular type of C. neoformans.
Sequenced Data
ITS of MYA-4567:

TTTCCGTAGGTGAACCTGCGGAAGGATCAGTAGAGAATATTGGACTTTGGTCCATTTATCTACCCATCTACACCTGTGAACTGTTTATGTGCTTCGGCACGTTTTACACAAACTTCTAAATGTAATGAATGTAATCATATTATAACAATAATAAAACTTTCAACAACGGATCTCTTGGCTTCCACATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCAACTTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTTGAGAGTCATGAAAATCTCAATCCCTCGGGTTTTATTACCTGTTGGACTTGGATTTGGGTGTTTGCCGCGACCTGCAAAGGACGTCGGCTCGCCTTAAATGTGTTAGTGGGAAGGTGATTACCTGTCAGCCCGGCGTAATAAGTTTCGCTGGGCCTATGGGGTAGTCTTCGGCTTGCTGATAACAACCATCTCTTTTTGTTTGACCTCAAATCAGGTAGGGCTACCCGCTGAACTTAAGCATATCAAT


D1D2 region of the 28S ribosomal RNA gene:

ATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCTTAGTAACGGCGAGTGAACCGGGAAGAGCTCAAATTTGAAATCTGGCGTCCTCCGGGCGTCCGAGTTGTAATCTACAGAAACGTTTTCCGTGCTGGACCGTGTCTAAGTCCCTTGGAATAGGGTATCAAAGAGGGTGACAATCCCGTACTTGACACGATCACCAGTGCTCTGTGATACGTTTTCTACGAGTCGCGTTACTTGGGAGTGTAGCGCAAAATGGGTGGTAAACTCCATCTAAAGCTAAATATTGGTGGAAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGATTGAAGTCAGTCGTGTCTATTGGGTTCAGCCAGTTCTGCTGGTGTATTCCCTTTAGACGGGTCAACATCAGTTCTGATCGGTGGATAAGGGCTGGAGGAATGTGGCACTCTTCGGGGTGTGTTATAGCCTCCTGTCGCATACACTGGTTGGGACTGAGGAATGCAGCTCGCCTTTATGGCCGGGGTTCGCCCACGTTCGAGCTTAGGATGTTGACAAAATGGCTTTAAACGA

Name of Depositor KJ Kwon-Chung
Special Collection ATCC
Chain of Custody
ATCC <-- KJ Kwon-Chung <-- W Meyer <-- S Chen
Isolation
Human, Australia.
Cross References

Nucleotide (GenBank) : FJ914894 ITS including 5.8S rRNA gene

References

Meyer W, et al. Molecular Typing of IberoAmerican Cryptococcus neoformans Isolates. Emerg. Infect. Dis. 9: 189-195, 2003.

Meyer W. et al. Consensus multi-locus sequence typing scheme for Cryptococcus neoformans and Cryptococcus gattii. Med. Mycol. 47(6):561-570, 2009. PubMed: 19462334

McTaggart LR, et al. Rapid identification of Cryptococcus neoformans and Cryptococcus gattii by matrix-assisted laser desorption ionization-time of flight mass spectrometry. J. Clin. Microbiol. 49: 3050-3053, 2011. PubMed: 21653762