Aspergillus lentulus Balajee et Marr (ATCC® MYA-3566)

Strain Designations: FH5  /  Product Format: frozen

Permits and Restrictions

View Permits

Deposited As Aspergillus lentulus
Strain Designations FH5
Application
Biomedical Research and Development Material
Biosafety Level 2
Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain yes
Preceptrol® no
Comments
Clinical isolate
Morphology Colonies on MEA attain a diameter of 30 to 35 mm after 7 days at 25°C and 50 to 55 mm after 7 days at 37°C. Colony texture is mostly floccose, and colonies are usually white, interspersed with olive-green colonies. Isolates often sporulate poorly, giving the colony a whitish appearance. In reverse, colonies are yellow in color with no diffusible pigment.
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

GGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACCGAGTGAGGGCCCTCTGGGTCCAACCTCCCACCCGTGTCTATCGTACCTTGTTGCTTCGGCGGGCCCGCCGTTTCGACGGCCGCCGGGGAGGCCTCGCGCCCCCGGGCCCGCGCCCGCCGAAGACCCCAACATGAACGCTGTTCTGAAAGTATGCAGTCTGAGTTGATTATCATAATCAGTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCACGGCTTGTGTGTTGGGCCCCGTCCCCTCCCCCGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTTGTCACCCGCTCTGTAGGCCCGGCCGGCGCCAGCCGACACCCAACTTTATTTTCTAAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAA


D1D2 region of the 28S ribosomal RNA gene

ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAAGAGCTCAAATTTGAAAGCTGGCCCCCTCGGGGTCCGCGTTGTAATTTGCAGAGGATGCTTCGGGTGCAGCCCCCGTCTAAGTGCCCTGGAACGGGCCGTCATAGAGGGTGAGAATCCCGTCTGGGACGGGGTGTCTGCGTCCGTGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATACTGGCCGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACTCGCCCGCGGGGTTCAGCCGGCATTCGTGCCGGTGTACTTCCCCGTGGGCGGGCCAGCGTCGGTTTGGGCGGCCGGTCAAAGGCCCTCGGAATGTATCACCTCTCGGGGTGTCTTATAGCCGAGGGTGCAATGCGGCCTGCCCGGACCGAGGAACGCGCTTCGGCTCGGACGCTGGCGTAATGGTCGTAAATGAC

Morphology Colonies on MEA attain a diameter of 30 to 35 mm after 7 days at 25°C and 50 to 55 mm after 7 days at 37°C. Colony texture is mostly floccose, and colonies are usually white, interspersed with olive-green colonies. Isolates often sporulate poorly, giving the colony a whitish appearance. In reverse, colonies are yellow in color with no diffusible pigment.
Name of Depositor KA Marr, K Lafe
Special Collection NSF - Mycology
Chain of Custody
ATCC <-- KA Marr, K Lafe
K A Marr Fred Hutchinson Cancer Research Center
Isolation
Clinical specimen of a patient hospitalized at the Fred Hutchinson Cancer Research Center, Seattle, WA, USA.
Year of Origin July 2, 2000
References

Balajee SA, et al. Aspergillus lentulus sp. nov., a new sibling species of A. fumigatus. Eukaryot. Cell 4: 625-632, 2005. PubMed: 15755924

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation