Aspergillus lentulus Balajee et Marr (ATCC® MYA-3566)

Strain Designations: FH5 [IFM 54703, CBS 117885, NRRL 35552]  /  Product Format: frozen

Permits and Restrictions

View Permits

Deposited As Aspergillus lentulus
Strain Designations FH5 [IFM 54703, CBS 117885, NRRL 35552]
Application
Biomedical Research and Development Material
Biosafety Level 2

Biosafety  classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain yes
Preceptrol® no
Genome Sequenced Strain

Yes

Comments
Clinical isolate
Genome sequencing strain (Medical Mycology Research Center, Chiba University, Japan)
Morphology Colonies on MEA attain a diameter of 30 to 35 mm after 7 days at 25°C and 50 to 55 mm after 7 days at 37°C. Colony texture is mostly floccose, and colonies are usually white, interspersed with olive-green colonies. Isolates often sporulate poorly, giving the colony a whitish appearance. In reverse, colonies are yellow in color with no diffusible pigment.
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

GGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACCGAGTGAGGGCCCTCTGGGTCCAACCTCCCACCCGTGTCTATCGTACCTTGTTGCTTCGGCGGGCCCGCCGTTTCGACGGCCGCCGGGGAGGCCTCGCGCCCCCGGGCCCGCGCCCGCCGAAGACCCCAACATGAACGCTGTTCTGAAAGTATGCAGTCTGAGTTGATTATCATAATCAGTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCACGGCTTGTGTGTTGGGCCCCGTCCCCTCCCCCGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTTGTCACCCGCTCTGTAGGCCCGGCCGGCGCCAGCCGACACCCAACTTTATTTTCTAAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAA


D1D2 region of the 28S ribosomal RNA gene

ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAAGAGCTCAAATTTGAAAGCTGGCCCCCTCGGGGTCCGCGTTGTAATTTGCAGAGGATGCTTCGGGTGCAGCCCCCGTCTAAGTGCCCTGGAACGGGCCGTCATAGAGGGTGAGAATCCCGTCTGGGACGGGGTGTCTGCGTCCGTGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATACTGGCCGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACTCGCCCGCGGGGTTCAGCCGGCATTCGTGCCGGTGTACTTCCCCGTGGGCGGGCCAGCGTCGGTTTGGGCGGCCGGTCAAAGGCCCTCGGAATGTATCACCTCTCGGGGTGTCTTATAGCCGAGGGTGCAATGCGGCCTGCCCGGACCGAGGAACGCGCTTCGGCTCGGACGCTGGCGTAATGGTCGTAAATGAC

Morphology Colonies on MEA attain a diameter of 30 to 35 mm after 7 days at 25°C and 50 to 55 mm after 7 days at 37°C. Colony texture is mostly floccose, and colonies are usually white, interspersed with olive-green colonies. Isolates often sporulate poorly, giving the colony a whitish appearance. In reverse, colonies are yellow in color with no diffusible pigment.
Name of Depositor KA Marr, K Lafe
Special Collection NSF - Mycology
Chain of Custody
ATCC <-- KA Marr, K Lafe
K A Marr Fred Hutchinson Cancer Research Center
Isolation
Clinical specimen of a patient hospitalized at the Fred Hutchinson Cancer Research Center, Seattle, WA, USA.
Year of Origin July 2, 2000
Cross References

Nucleotide (GenBank) : BCLY00000000 Aspergillus lentulus strain IFM 54703, whole genome shotgun sequencing project

References

Balajee SA, et al. Aspergillus lentulus sp. nov., a new sibling species of A. fumigatus. Eukaryot. Cell 4: 625-632, 2005. PubMed: 15755924

Hong SB, et al. Polyphasic taxonomy of Aspergillus fumigatus and related species. Mycologia 97: 1316-1329, 2005. PubMed: 16722222

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation