Candida dubliniensis Sullivan et al. (ATCC® MYA-179)

Strain Designations: CD410  /  Product Format: frozen

Strain Designations CD410
Application
Biomedical Research and Development Material
Biosafety Level 2

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Morphology After 3 days at 30°C growth is white to cream-colored, glistening, butyrous, soft and smooth.  Cells are globose to ovoidal with abundant presence of branched pseudohyphae. 
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

GGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACTGATTTGCTTAATTGCACCACATGTGTTTTGTTCTGGACAAACTTGCTTTGGCGGTGGGCCCCTGCCTGCCGCCAGAGGACATAAACTTACAACCAAATTTTTTATAAACTTGTCACGAGATTATTTTTAATAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATATGAATTGCAGATATTCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGAGGGCATGCCTGTTTGAGCGTCGTTTCTCCCTCAAACCCCTAGGGTTTGGTGTTGAGCAATACGACTTGGGTTTGCTTGAAAGATGATAGTGGTATAAGGCGGAGATGCTTGACAATGGCTTAGGTGTAACCAAAAACATTGCTAAGGCGGTCTCTGGCGTCGCCCATTTTATTCTTCAAACTTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAA


D1D2 region of the 26S ribosomal RNA gene

ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAGCGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCGTCTTTGGCGTCCGAGTTGTAATTTGAAGAAGGTATCTTTGGGCCCGGCTCTTGTCTATGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTGCGATGAGATGGCCCGGGTCTATGTAAAGTTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGTATTTTGCAAGTTACTCTTTCGGGGGTGGCCTCTGCGGTTTACCGGGCCAGCATCGGTTTGGAGCGGTAGGATAATGGCGGGGGAATGTGGCACGACTTTGGTTGTGTGTTATAGCCTCTGACGATACTGCCAGCCTAGACCGAGGACTGCGGTTTTTACCTAGGATGTTGGCATAATGATCTTAAGTCGC

Morphology After 3 days at 30°C growth is white to cream-colored, glistening, butyrous, soft and smooth.  Cells are globose to ovoidal with abundant presence of branched pseudohyphae. 
Name of Depositor DJ Sullivan
Special Collection NCRR Contract
Isolation Human oral cavity, Ireland
Year of Origin 1999
References

Derek J Trinity College, Dublin, personal communication