Epidermophyton floccosum (Harz) Langeron et Milochevitch (ATCC® 9646)

Strain Designations: 1282  /  Product Format: frozen

Strain Designations 1282
Application
Biomedical Research and Development Material
Biosafety Level 2

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

GATCATTAACGCGCAGGCCGCAGTCGGCCCGTCCCCCTTCTCTCTGAATGCTGGACGGTGTCGCCGGCCACACGCCCATTCTTGTCTACACTACCCGGTTGCCTCGGCGGGCCGCGCCCCCTAGGCTGCAGTGTCGCTGCAGCGTCTCGGGGGGGCCGTTCGGGGGATGGAGAAGGATGCCCCGGCGGGGTTGATCGCTCCCCCACCCCTGGACAGCGCTCGCCGAAGGAGTGATTCTCAGAAATTCTACGAAATCTCCATAGGTGGTTCAGTCTGAGCGTTGGCAAGCAAAAACCAGTCAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCAACCCCTCAAGCCCGGCTTGTGTGATGGACGACCGTCCGACCGCCTTTGCATCCCCCGTTCCACCGGGAGAGGAGAAAGGTGGAGGGGACGCGCCCGAAAAGCAGTGGCCAGGCCGCGATTCCGGGCCCCTGGGCGAATGGGCAACAAAACCAGCGCCTTCAGGACCGGCCGGCTCTCTGGCCCTAGTTTCCGTCGGGAGGACGAAAGGGGGCGACCCCTCTCTCCCCTCCGCATTCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAA

Name of Depositor CW Emmons