Cryptococcus neoformans var. grubii Franzot et al. (ATCC® 90113)

Strain Designations: 7241/9.829 MCV 13 [NCCLS 98]  /  Product Format: freeze-dried

Deposited As Cryptococcus neoformans (Sanfelice) Vuillemin
Strain Designations 7241/9.829 MCV 13 [NCCLS 98]
Application
susceptibility testing antifungal agents
Biomedical Research and Development Material
Biosafety Level 2

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Comments
Autonomous effect of combination of fluconazole and flucytosine
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

GGTTTCCGTAGGTGAACCTGCGGAAGGATCAGTAGAGAATATTGGACTTCGGTCCATTTATCTACCCATCTACACCTGTGAACTGTTTATGTGCTTCGGCACGTTTTACACAAACTTCTAAATGTAATGAATGTAATCTTATTATAACAATAATAAAACTTTCAACAACGGATCTCTTGGCTTCCACATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCAACTTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTTGAGAGTCATGAAAATCTCAATCCCTCGGGTTTTATTACCTGTTGGACTTGGATTTGGGTGTTTGCCGCGACCTGCAAAGGACGTCGGCTCGCCTTAAATGTGTTAGTGGGAAGGTGATTACCTGTCAGCCCGGCGTAATAAGTTTCGCTGGGCCTATGGGGTAGTCTTCGGCTTGCTGATAACAACCATCTCTTTTTGTTTGACCTCAAATCAGGTAGGGCTACCCGCTGAACTTAAGCATATCAATAA


D1D2 region of the 26S ribosomal RNA gene

ATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCTTAGTAACGGCGAGTGAACCGGGAAGAGCTCAAATTTGAAATCTGGCGTCCTCCGGGCGTCCGAGTTGTAATCTACAGAAACGTTTTCCGTGCTGGACCGTGTCTAAGTCCCTTGGAATAGGGTATCAAAGAGGGTGACAATCCCGTACTTGACACGATCACCAGTGCTCTGTGATACGTTTTCTACGAGTCGCGTTACTTGGGAGTGTAGCGCAAAATGGGTGGTAAACTCCATCTAAAGCTAAATATTGGTGGAAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGATTGAAGTCAGTCGTGTCTATTGGGTTCAGCCAGTTCTGCTGGTGTATTCCCTTTAGACGGGTCAACATCAGTTCTGATCGGTGGATAAGGGCTGGGGGAATGTAGCACTCTTCGGAGTGTGTTATAGCCTCCTGTCGCATACACTGGTTGGGACTGAGGAATGCAGCTCGCCTTTATGGCCGGGGTTCGCCCACGTTCGAGCTTAGGATGTTGACAAAATGGCTTTAAACGAC

Name of Depositor A Espinel-Ingroff
Isolation
Cerebrospinal fluid, Pennsylvania
References

Espinel-Ingroff A, et al. Collaborative comparison of broth macrodilution and microdilution antifungal susceptibility tests. J Clin Microbiol 30: 3138-3145, 1992. PubMed: 1452697

Nguyen MH, et al. In vitro evaluation of combination of fluconazole and flucytosine against Cryptococcus neoformans var. neoformans. Antimicrob. Agents Chemother. 39: 1691-1695, 1995. PubMed: 7486902

Yamada Y, et al. Phylogenetic relationships among medically important yeasts based on sequences of mitochondrial large subunit ribosomal RNA gene. Mycoses 47: 24-28, 2004. PubMed: 14998395

Imai T, et al. Geographic grouping of Cryptococcus neoformans var. gattii by random amplified polymorphic DNA fingerprint patterns and ITS sequence divergence. Clin Lab 46: 345-354, 2000. PubMed: 10934581