Cerinosterus cyanescens (de Hoog et de Vries) Moore (ATCC® 76558)

Strain Designations: CDC B-4620 [UAMH 6107]  /  Product Format: frozen

Permits and Restrictions

View Permits

Deposited As Sporothrix cyanescens de Hoog et de Vries, anamorph
Strain Designations CDC B-4620 [UAMH 6107]
Application
Biomedical Research and Development Material
Biosafety Level 2
Product Format frozen
Type Strain no
Preceptrol® no
Comments
Potential virulence
Morphology

After 7 days at 37°C colonies velvety, compact, white.  Conidiogenous cells undifferentiated, cylindrical, of variable size (1.5-3 um wide).  Conidia abundant, hyaline, smooth-walled to finely verrucose, obovoidal, 3-4 um long. 

Medium ATCC® Medium 336: Potato dextrose agar (PDA)
Growth Conditions
Temperature: 37.0°C
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal   transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.

   GAGAGTGTATCACAAAGCACTGGGCGTCCATGTCAAGTACGGGATTTTCACCCTCTATGACGTCCTATTCCAAGGAACTTGTACATGGTCCAGCACGGAAAACACTTCTCGAGATTACAACGCGACACCGAAGGTGCCAGCTTTCAAATTTGAGCTCTTCCCGCTTCACTCGCCGTTACTAGGGGAATCCTTGTTAGTTTCTTTTCCTCCGCTTATTGATATGCTTAAGTTCAGCGGGTAGTCCTACCTGTTTGAGGCCAGAGTTGTAAATGAATTGGGTCGAGGATGGAACCTCTTGCCGGATTAGAAGCAGACTTCTCACACTTCCCAAGCATAGTCTTGACCCACCGATGCAAATTTATCACATCAAGTGGAACATCCAAGAGTCTCGGAGAGTCCAGCTAATATCTTTAAGGCCAGCTGCCGTGAAGCAGCAATATAGGCCCACAACCAAACCCAAGCAATGAATTTTGCAAAACATTGGGGTTTGAGGAATTCATGACATCAAACAGGCATGCTCCTAGGAATACCAGGGAGCGCAAGGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCAATTCGCTGCGTTCTTCATCGATGGGAGAACCAGAGATCCGTTGTCGAAAGTTGTATTTAATTTCGCCAAAAATTGGCAAGTTAAATTCACATTCATAGTTCTCAGAGTTTGTATAATTGGCGTTGGCAGGCGATAAACCAAAGGTTCACACCTAACCAAAGTGCACAAGTGTATGTGGATAATGTGAGGGTCGGGATCCACAGAGTGGAGTCCCTAAAATTCACTAATGATCCTTCTGCAGGTTCACCTACAGAAACCTTGTTAC

Morphology

After 7 days at 37°C colonies velvety, compact, white.  Conidiogenous cells undifferentiated, cylindrical, of variable size (1.5-3 um wide).  Conidia abundant, hyaline, smooth-walled to finely verrucose, obovoidal, 3-4 um long. 

Name of Depositor AA Padhye
Isolation
human blood, Connecticut
References

Sigler L, et al. Microbiology and potential virulence of Sporothrix cyanescens, a fungus rarely isolated from blood and skin. J. Clin. Microbiol. 28: 1009-1015, 1990. PubMed: 2351719

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation