Cerinosterus cyanescens (de Hoog et de Vries) Moore (ATCC® 76558)

Strain Designations: CDC B-4620 [UAMH 6107]  /  Product Format: frozen

Permits and Restrictions

View Permits

Deposited As Sporothrix cyanescens de Hoog et de Vries, anamorph
Strain Designations CDC B-4620 [UAMH 6107]
Application
Biomedical Research and Development Material
Biosafety Level 2

Biosafety  classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format frozen
Type Strain no
Preceptrol® no
Comments
Potential virulence
Morphology

After 7 days at 37°C colonies velvety, compact, white.  Conidiogenous cells undifferentiated, cylindrical, of variable size (1.5-3 um wide).  Conidia abundant, hyaline, smooth-walled to finely verrucose, obovoidal, 3-4 um long. 

Medium ATCC® Medium 336: Potato dextrose agar (PDA)
Growth Conditions
Temperature: 37.0°C
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal   transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.

   GAGAGTGTATCACAAAGCACTGGGCGTCCATGTCAAGTACGGGATTTTCACCCTCTATGACGTCCTATTCCAAGGAACTTGTACATGGTCCAGCACGGAAAACACTTCTCGAGATTACAACGCGACACCGAAGGTGCCAGCTTTCAAATTTGAGCTCTTCCCGCTTCACTCGCCGTTACTAGGGGAATCCTTGTTAGTTTCTTTTCCTCCGCTTATTGATATGCTTAAGTTCAGCGGGTAGTCCTACCTGTTTGAGGCCAGAGTTGTAAATGAATTGGGTCGAGGATGGAACCTCTTGCCGGATTAGAAGCAGACTTCTCACACTTCCCAAGCATAGTCTTGACCCACCGATGCAAATTTATCACATCAAGTGGAACATCCAAGAGTCTCGGAGAGTCCAGCTAATATCTTTAAGGCCAGCTGCCGTGAAGCAGCAATATAGGCCCACAACCAAACCCAAGCAATGAATTTTGCAAAACATTGGGGTTTGAGGAATTCATGACATCAAACAGGCATGCTCCTAGGAATACCAGGGAGCGCAAGGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCAATTCGCTGCGTTCTTCATCGATGGGAGAACCAGAGATCCGTTGTCGAAAGTTGTATTTAATTTCGCCAAAAATTGGCAAGTTAAATTCACATTCATAGTTCTCAGAGTTTGTATAATTGGCGTTGGCAGGCGATAAACCAAAGGTTCACACCTAACCAAAGTGCACAAGTGTATGTGGATAATGTGAGGGTCGGGATCCACAGAGTGGAGTCCCTAAAATTCACTAATGATCCTTCTGCAGGTTCACCTACAGAAACCTTGTTAC

Morphology

After 7 days at 37°C colonies velvety, compact, white.  Conidiogenous cells undifferentiated, cylindrical, of variable size (1.5-3 um wide).  Conidia abundant, hyaline, smooth-walled to finely verrucose, obovoidal, 3-4 um long. 

Name of Depositor AA Padhye
Isolation
human blood, Connecticut
References

Sigler L, et al. Microbiology and potential virulence of Sporothrix cyanescens, a fungus rarely isolated from blood and skin. J. Clin. Microbiol. 28: 1009-1015, 1990. PubMed: 2351719

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation