Pythium destruens Shipton (ATCC® 64221)

Strain Designations: S5  /  Product Format: frozen

Permits and Restrictions

View Permits

Strain Designations S5
Application
Biomedical Research and Development Material
Biosafety Level 2

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain yes (type strain)
Preceptrol® no
Comments Equine pythiosis
This species is considered as synonym of Pythium insidiosum
Morphology Colonies on Cornmeal agar after 15 days at 25°C, appressed and off-white. Hyphae are hyaline and guttulate. Sporangia and oogonia were not observed.
Medium ATCC® Medium 307: Cornmeal agar
Growth Conditions
Temperature: 24°C to 26°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

TTCCACGTGAACCGTTCTAAATATGTTCTGTGCTTCGTCGAAGCAAACTGCTCTCTTTTTGAGAGTGGTGCGCGACGGCTTGAGGCTGAACGAAGGTTGGCTCAGTACTCGTATGACTCTCGGGTTGTGCGGTGGAACAGCTTGCCGATGTCTTTTTCAAACCCATTTTACTAAACACTGATCTATACTCCGAGGACGAAAGTCTTTGGTTTTAATCCATTAACAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTTCGGGTTATGCCTGGAAGTATGCCTGTATCAGTGTCCGTACATCAAACTTGCCTTTCTTTTTCTGTGTAGTCAGGAATGGAGATGGCAGAATGTGAGGTGTCTCGAGCCGTCCCCTCTTTTGGGA


D1D2 region of the 28S ribosomal RNA gene

CATATTAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGCGGGATGAGCTCAAGCTTAAAATCTCTGTGCAGGTTCTGCATGGCGAATTGTAGTCTATGGAGGCGATGTCAGTGCGGTTGTGCGGGATAAGTTCCTTGGAAGAGGACAGCATCGAGGGTGATACTCCCGTATGTGCCTGTGCAGCTGCGCGTACGACACGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAATCGAATCGTTTCCAGTGTCTATAATCCATGACATATTTCATTGGCGCGTGAATGCGTGCAGCGTTTTGGAAGTGGGTTTCCTCTCCTGGCGTTGTTGTGCGTTTGCTTGCTGGTGCCCTGTGTTGTGGTGGGACGTCAGAGTCAGTTCGTATGCCGCGGGAAATGGCTGTCAGGGAGGTAGGTCGCTTCGGTGGCTGTTATAGCCTGGCAGTTAGTAGTCGTGGTTGGGACTGAGGTGCCTACAACGCGCTTTCGAGTCTGCGGGACTCTCGTCTGGTTGCCTGCTTGGACAGCTTGCTGTGCTAGTGGTCACATCGGGCGATTGAGATCTGTAGTAACTTGTTGCCGTTCGGGACTTTGACGAAATGGAGCGATTCGTC

Morphology Colonies on Cornmeal agar after 15 days at 25°C, appressed and off-white. Hyphae are hyaline and guttulate. Sporangia and oogonia were not observed.
Name of Depositor WA Shipton
Chain of Custody
ATCC <-- WA Shipton <-- RI Miller
Isolation
Horse, Australia
References

Schurko AM, et al. A molecular phylogeny of Pythium insidiosum. Mycol. Res. 107: 537-544, 2003. PubMed: 12884950

Shipton WA. Pythium destruens sp. nov., an agent of equine pythiosis. J. Med. Vet. Mycol. 25: 137-151, 1987. PubMed: 3612431

type strain

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation