Blastomyces dermatitidis Gilchrist et Stokes (ATCC® 60636)

Alternate State: Ajellomyces dermatitidis McDonough et Lewis  /  Strain Designations: S-986  /  Product Format: frozen

Permits and Restrictions

View Permits

Strain Designations S-986
Alternate State Ajellomyces dermatitidis McDonough et Lewis
Application
Biomedical Research and Development Material
Emerging infectious disease research
Biosafety Level 2

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Comments
Exhibits protein antigen WI-1
Medium ATCC® Medium 726: Brain heart infusion with cystine
Growth Conditions
Temperature: 37°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.

TCCTAGACCGGAGGACCCCGGCCCCCTCACCTGGCCACCCTTGTCTATTTTTACCTGTTGCTTCGGCGGGCCTGCAGCGATGCTGCCGGGGGAGTTTTCACTCCCCGGGCTCGTGCCCGCCGAGGACACCGCTAGAACTTCTGGTGAACGATTGACTTCTGAAAAAAAAACTWAATCAGTTAAAACTTTCAACAACGGATCTTTTGGTTCCGACATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGCGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCAACCCTCAAGCGCGGCTTGTGTGTTGGGCCTTCGTCCCCCCGTGGACGTGCCCGAAATGCAGCGGCGGCGTCGTGTTCCGGTGCCCGAGCGTATGGGGCTTTGTCACCCGCTCTAGAGGCCCGGCCGGCTCCGGCCCCATCTCAAACCCTTCGAGGGAGGGCGGTCTTCGGGCCGGTCTCCCCACCAGGTTGACCTCGGA

Name of Depositor AF DiSalvo
Chain of Custody
ATCC <-- AF DiSalvo <-- P. Morris
Isolation
Soil, Eagle River bank, Wisconsin
Cross References

Nucleotide (GenBank) : HQ026734 ITS including 5.8S rRNA gene

References

Chang WL, et al. T-Cell epitopes and human leukocyte antigen restriction elements of an immunodominant antigen of Blastomyces dermatitidis. Infect. Immun. 68: 502-510, 2000. PubMed: 10639410

Brown EM, et al. Phylogenetic analysis reveals a cryptic species Blastomyces gilchristii, sp. nov. within the human pathogenic fungus Blastomyces dermatitidis. PLoS One 8: e59237, 2013. PubMed: 23533607

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • USDA APHIS VS 16-6 or 16-6A permit must be obtained and a copy of the permit must be sent to ATCC in advance of shipment. The Application Form VS 16-3 (Import controlled material import or transport organisms or vectors) must be submitted to USDA APHIS Veterinary Services to obtain the VS 16-6 or 16-6A permit.
  • Customer Acceptance of Responsibility, ATCC Form 62 required for distribution.
  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation