Saksenaea vasiformis Saksena, teleomorph (ATCC® 60625)

Product Format: frozen

Permits and Restrictions

View Permits

Deposited As Saksenaea vasiformis Saksena
Application
Biomedical Research and Development Material
Biosafety Level 2
Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Comments
Nosocomial infection
Medium ATCC® Medium 336: Potato dextrose agar (PDA)
Growth Conditions
Temperature: 25°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

CATTACTGGTAGTCTCTTTTTGGTACTGAATTTTCAGGCCGGAAGAGATAATCTTATCCTGTGCAATGAACTTGTCGCCTGGGGTTTGAATATAGTCTTTGTGGGAGTGTGTAAAAGCTCTTTCGCATTGCTGACCCCAATAGGCATCCTTTCCAATACTTTTTGGTATTAAAACACTATTGTATTTTTTTTAACTGAAATCGATATCTTTGCTATAAAGATTATAACCAAATGGGCTATTTTGGCTTGTTTGAAAAAACAACTTTCAGCAATGGATCTCTTGGTTCTCGCATCGATGAAGAACGTAGCAAACTGCGATAAGTAGTGTGAATTGCATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCACTCACTGGTATTCCGGTGAGTACGCCTGTTTCAGTATCATTGAAAACCCACAACCAAATATTTTTGTTTGGTTGGACTTGGGCTATTCGTTTGGTAGTCATGGTATTAATTTTTTAATGCCAAACGACAAGCCAAGCAGCCTGGAATTTATTGAATGGTCAATTGTATCGTAGTAATCATTATACAAGACCTGAGCTTTATAAACGAACTGGGCTTCTTTGATTTGACCAGTTTTAGCTCTAGTCATTGGGATTACCGTAAATCGATCTTGGCTTCATGGTCTAGTCAGCTTTGGCTGTCTAAATCAGTACCAAATCATCTTCTCAGTATCGATCTGAAATCAGGTGGGACTACCCGCTGAACTTAAG


D1D2 region of the 28S ribosomal RNA gene

AATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCTCAGTAACGGCGAGTGAACAGGGAACAAGCTCAAAGTTGGAATCTATCTGGCCTAGCCAGATCGAATTGTAAACTTTAGAGTCGTTATCCAGACCAGCCGAGTAAATAAGTTCCTTGGAATAGGACATCATGGAGGGTGAGAATCCCGTCTTTGGCTTGAGCATTGGTCTTTTGTGATGCGGCTTCAACGAGTCAGGTTGTTTGGGAATGCAGCCTTAATTGGGTGGTAAATCTCACCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAACAGTATGTGAAATTGCTGAAAGGGAACCGTTTGAAGCCAGTCTGGCTGGTCTGCAATCAACTTCGGCTTTGGTTGGAGTGCACTTGTAGGCCGTTCGCCTGCCAACAACAGTTTATACTGCAGCAAAAAGGTGCTGAGAATGTGGCTTTCCTTCGGGAAAGTGTTATAGCTCGGTACGAAATACTGTGGTTTAGACTGAGGCTCGCAGTGAATGCTTTTTGGCTTTGGAAGTGGGTCGCTCAGTAGTCAGTAAGTTAGTCTTCGGCCGTAAAAAAGTCGTGCTGGCTTACCTGATTGCTGACCCGGCTTGCTTGCTTTTAATTCACTTTGGTTGTTGGCGTAATGGCTTTAAACGA

Name of Depositor AD Oberle
Isolation
Human wrist lesion at arterial catheter site, Louisiana.
Cross References

Nucleotide (GenBank) : AX110053 Sequence 786 from Patent WO0123604.

Nucleotide (GenBank) : AX110936 Sequence 1669 from Patent WO0123604.

References

Oberle AD, Penn RL. Nosocomial invasive Saksenaea vasiformis infection. Am. J. Clin. Pathol. 80: 885-888, 1983. PubMed: 6637898

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation