Epidermophyton floccosum (Harz) Langeron et Milochevitch, anamorph (ATCC® 52063)

Strain Designations: 2108  /  Product Format: frozen

Permits and Restrictions

View Permits

Strain Designations 2108
Application
Biomedical Research and Development Material
Biosafety Level 2

Biosafety  classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Comments
taxonomy
Medium ATCC® Medium 28: Emmons' modification of Sabouraud's agar
ATCC® Medium 336: Potato dextrose agar (PDA)
Growth Conditions Temperature: 30°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

GGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAACGCGCAGGCCGCAGTCGGCCCGTCCCCCTTCTCTCTGAATGCTGGACGGTGTCGCCGGCCACACGCCCATTCTTGTCTACACTACCCGGTTGCCTCGGCGGGCCGCGCCCCCTAGGCTGCAGTGTCGCTGCAGCGTCTCGGGGGGGCCGTTCGGGGGATGGAGAAGGATGCCCCGGCGGGGTTGATCGCTCCCCCACCCCTGGACAGCGCTCGCCGAAGGAGTGATTCTCAGAAATTCTACGAAATCTCCATAGGTGGTTCAGTCTGAGCGTTGGCAAGCAAAAACCAGTCAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCAACCCCTCAAGCCCGGCTTGTGTGATGGACGACCGTCCGACCGCCTTTGCATCCCCCGTTCCACCGGGAGAGGAGAAAGGTGGAGGGGACGCGCCCGAAAAGCAGTGGCCAGGCCGCGATTCCGGGCCCCTGGGCGAATGGGCAACAAAACCAGCGCCTTCAGGACCGGCCGGCTCTCTGGCCCTAGTTTCCGTCGGGAGGACGAAAGGGGGCGACCCCTCTCTCCCCTCCGCATTCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAA

Name of Depositor WC Noble
Isolation
human groin
References

Jones MG, Noble WC. A study of fatty acids as a taxonomic tool for dermatophyte fungi. J. Appl. Bacteriol. 50: 577-583, 1981. PubMed: 7251521

Jones MG, Noble WC. An electrophoretic study of enzymes as a tool in the taxonomy of the dermatophytes. J. Gen. Microbiol. 128: 1101-1107, 1982. PubMed: 7108488

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation