Exophiala dermatitidis (Kano) de Hoog, anamorph (ATCC® 44504)

Strain Designations: JL-3 [Mel-3]  /  Product Format: freeze-dried

Deposited As Wangiella dermatitidis (Kano) McGinnis
Strain Designations JL-3 [Mel-3]
Application
Biomedical Research and Development Material
Biosafety Level 2

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format freeze-dried
Type Strain no
Genotype mel3 RefBrush L, Money NP. Invasive hyphal growth in Wangiella dermatitidis is induced by stab inoculation and shows dependence upon melanin biosynthesis. Fungal Genet. Biol. 28: 190-200, 1999. PubMed: 10669584
Phenotype melanin-deficient RefBrush L, Money NP. Invasive hyphal growth in Wangiella dermatitidis is induced by stab inoculation and shows dependence upon melanin biosynthesis. Fungal Genet. Biol. 28: 190-200, 1999. PubMed: 10669584
Preceptrol® no
Ploidy haploid
Comments
Synthesis of melanin-like pigments
Morphology melanin-deficient RefBrush L, Money NP. Invasive hyphal growth in Wangiella dermatitidis is induced by stab inoculation and shows dependence upon melanin biosynthesis. Fungal Genet. Biol. 28: 190-200, 1999. PubMed: 10669584
Medium ATCC® Medium 28: Emmons' modification of Sabouraud's agar
Growth Conditions
Temperature: 24.0°C
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.

TCTTCTCAGGCCCGACCTCCCACCCTTTGTTTACCCGACCCATGTTGCTTCGGCGGGCCCGCCGTTTCGACGGCCGCCGGAGGACCGCCTATTCAGGTCCTCTGGCCCGCGCCCGCCGGTAGCCAATTCTACCAAACTCTTGAATCAAATCGTGTCCAATGTCTGAGTATATTACAAAATAAAAGCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGCGAATTGCAGAATTCCAGTGAGTCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTCGAGCGTCATTATCACCCCTCAAGCCCCCCGGCTTGGTGTTGGACGGTCTGGTCGAGCGTTTCCGCGCGACCCCTCCCAAAGACAATGACGGCGGCCTGGTTGGACCCCCGGTACACGGAGCTTCTTCACTGAGCACGTATCGGTTTCAAGGTGTCCCCGGGACCCGGTCGACCTCTCTTGCTCCCCTGCGGGAGTGGGAGAGAACCCCCCTTTTTATCAAGGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAAGCATATCA

 

Morphology melanin-deficient RefBrush L, Money NP. Invasive hyphal growth in Wangiella dermatitidis is induced by stab inoculation and shows dependence upon melanin biosynthesis. Fungal Genet. Biol. 28: 190-200, 1999. PubMed: 10669584
Name of Depositor PA Geis
Isolation
albino mutant derived from ATCC 34100
Cross References

Nucleotide (GenBank) : GU256756 ITS including 5.8S rRNA gene

References

Schnitzler N, et al. Effect of melanin and carotenoids of Exophiala (Wangiella) dermatitidis on phagocytosis, oxidative burst, and killing by human neutrophils. Infect. Immun. 67: 94-101, 1999. PubMed: 9864201

Brush L, Money NP. Invasive hyphal growth in Wangiella dermatitidis is induced by stab inoculation and shows dependence upon melanin biosynthesis. Fungal Genet. Biol. 28: 190-200, 1999. PubMed: 10669584

Brush L, Money NP. Invasive hyphal growth in Wangiella dermatitidis is induced by stab inoculation and shows dependence upon melanin biosynthesis. Fungal Genet. Biol. 28: 190-200, 1999. PubMed: 10669584

Brush L, Money NP. Invasive hyphal growth in Wangiella dermatitidis is induced by stab inoculation and shows dependence upon melanin biosynthesis. Fungal Genet. Biol. 28: 190-200, 1999. PubMed: 10669584

Brush L, Money NP. Invasive hyphal growth in Wangiella dermatitidis is induced by stab inoculation and shows dependence upon melanin biosynthesis. Fungal Genet. Biol. 28: 190-200, 1999. PubMed: 10669584

Brush L, Money NP. Invasive hyphal growth in Wangiella dermatitidis is induced by stab inoculation and shows dependence upon melanin biosynthesis. Fungal Genet. Biol. 28: 190-200, 1999. PubMed: 10669584