Malassezia furfur (Robin) Baillon (ATCC® 44349)

Strain Designations: M 201/78  /  Product Format: freeze-dried

Deposited As Pityrosporum orbiculare Gordon, anamorph
Strain Designations M 201/78
Application
Biomedical Research and Development Material
Biosafety Level 2

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format freeze-dried
Type Strain no
Preceptrol® no
Comments
Control with propylene glycol
Morphology

After 5 days at 30°C colonies cream to tan, cells ellipsoidal with monopolar budding from phialides with small collerettes.

Medium ATCC® Medium 1072: Pityrosporum medium
Growth Conditions
Temperature: 30.0°C
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal   transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.

TCATGCCATGCTCAGCGGTCGCTTAGCCACTCTTCCCTAGAGAGCGGTAGCGAGGGTCCTGGCGCTTATGCATTTCGGGCGAGCCTGGTACAATCCCCAGGCAGCAAACACCCATCCTACCCCGTCCGCCCTACTTCGGCCTTTCGGCCACCGTAAGGGGAGGGAGAATTCGCGGCACTCAAACAGGCATGCTCCACGGAATACCATGGAGCGCAAGGTGCGTTCAAAGATTCGATGATTCACGGAATTCTGCAATTCACATTACCTATCGCGTTTCGCTGCGTTCTTCATCGATGGGAGAACCAAGAGATCCGTTGTCGAAAGTTGTGTATAGTTCGTAGGCTATACCTACAATTTCACGTACATTCAACCATACGAGTTTTTTTTTGTTCGATGACATTCGTCATCACAGTGCACAGGGGTTGCTATGGATATAATGATGGGCGCCAGAGACGTGTTTGCGTCCGTATGGCAGGCCCGAAACTTTCACTAATGATCCTTCTGCAGGTTCACCTACAGAAACCTTGTT

Morphology

After 5 days at 30°C colonies cream to tan, cells ellipsoidal with monopolar budding from phialides with small collerettes.

Name of Depositor J Faergemann
References

Faergemann J, Fredriksson T. Antimycotic activity of propane-1,2-diol (propylene glycol). Sabouraudia 18: 163-166, 1980. PubMed: 7434130