Malassezia sympodialis Simmons et Guého (ATCC® 44338)

Strain Designations: M 505/78  /  Product Format: freeze-dried

Deposited As Pityrosporum orbiculare Gordon
Strain Designations M 505/78
Application
Biomedical Research and Development Material
Biosafety Level 2

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Comments
Control with propylene glycol
Medium ATCC® Medium 1072: Pityrosporum medium
Growth Conditions
Temperature: 30°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

AAGGATCATTAGTGAAAGTTTCGGGCCTGCCATACGGACGCAAACACGTCTCTGGCGCCCATCACTATATCCATACCAACCCCTGTGCACTGTGATGACGAATGTCATCGAACAAAAAAAAACTCGTATGGTTGAATGTACGTGAAATTGTAGGTATAGCCTACGAACTATACACAACTTTCGACAACGGATCTCTTGGTTCTCCCATCGATGAAGAACGCAGCGAAACGCGATAGGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCATGGTATTCCGTGGAGCATGCCTGTTTGAGTGCCGCGAATTCTCCCTCCCCTTACGGTGGCCGAAAGGCCGAAGTAGGGCGGACGGGGTAGGATGGGTGTTTGCTGCCTGGGGATTGTACCAGGCTCGCCCGAAATGCATAAGCGCCAGGACCCTCGCTACCGCTCTCTAGGGAAGAGTGGCTAAGCGACCGCTGAGCATGGCATGATACGTCATTTGCTGTGTGTGGGCGGCCGGTTGGAGAGGTGTCTGCTTTACCAGCCCTATTTTAATTCTGGTCTCAAATCAGGTAGGATCACCCGCTGAACTTAAG


D1D2 region of the 26S ribosomal RNA gene

CATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACGGCGAGCGAAGCGGGAAGAGCTCAAATTTGAAAGCTGGCACCTCCGGTGTCCGCGTTGTAATCTCGAGACGTGTTTTCCGTGCGGCTCTATGGACAAGTCCCTTGGAACAGGGCATCGTAGAGGGTGAAAATCCCGTACTTGCCATGGATGTACCGTGCTTTGTGATACACGCTCTAAGAGTCGAGTTGTTTGGGATTGCAGCTCAAAATGGGTGGTAGACTCCATCTAAAGCTAAATATCGGGGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAGTACGTGAAATTGTCGAAAGGGAAGCGCTTGAAGTCAGCCATGCTGCGCGGACTCAGCCCGGCTGATGCCTGGTGTATTTCCCAGCAGCAAGTCAGCATGGATTTGGATCGCCGGAGAAGGGTGGGAGGAATGTGGCACCCTCGGGTGTGTTAAGCCTCCTACTGGATACGGCGATTTGGATCCAGGAACGCAGTGTGCCTCTGGCGGGTCTTCGGACACCTTCACACTTAGGATGCTGGCGTAATGGCTTTAAGCGG

Name of Depositor J Faergemann
Isolation
Human, Sweden
References

name change made at request of the depositor, Jun 24 2002