Microsporum audouinii Gruby (ATCC® 42558)

Strain Designations: ET 384  /  Product Format: frozen

Strain Designations ET 384
Application
Biomedical Research and Development Material
Biosafety Level 2

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Comments
Tinea capitis
Morphology After 7-10 days colonies velutinous, tannish-white; reverse rose-brown. Later, macroconidia smooth-walled to sparsely echinulate, thick-walled, irregularly spindle-shaped, of variable size and cell number, mostly with slightly bent, verrucose apex. Microconidia not observed
Medium ATCC® Medium 28: Emmons' modification of Sabouraud's agar
ATCC® Medium 200: YM agar or YM broth
Growth Conditions
Temperature: 24°C to 26°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

TGCGGAAGGATCATTAACGCGCAAGAGGTCGAAGTTGGCCCCCGAAGCTCTTCCGTCTCCCCCCCCGGGCCTCCCGGGGAGGTTGCGGGCGGCGAGGGGTGCCTCCGGCCGCACGCCCATTCTTGTCTACTGACCCGGTTGCCTCGGCGGGCCGCGCCTGCTGTGCTACAGCGGCCGTTCGGGGGGGACGCCTGAGGGGGACTTTTGTTTCCTAGGCCACGCCCCGGGCAGCGCTCGCCGGAGGATTACTCTGGAAAACACACTCTTGAAAGAACATACCGTCTGAGCGAGCAACGCAAATCAGTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGCATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCAACCCCTCAAGCCCGGCTTGTGTGATGGACGACCGTCCCCCCCCAATAACCACCCACCGCTTAGGGGGGTGGGAGGGAGGGGGACGCGCCCGAAAAGCAGTGGTCAGGCCGCGATTCCGGCTCCTGGGCGAATGGGACATACCACCGCCTCTAGGACCGGCCGGTAGGCTGGCCTAACGCACCATGTATTATTCAGGTTGACCTCGGATCAGGTAGGGATACCC


D1D2 region of the 28 ribosomal RNA gene

CATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAAGAGCTCAAATTTGAAATCTGGCCTCCCTTGGGGGGTCCGAGTTGTAATTTGTAGAGGATGCTTCGGGTGTGGCCGCCGTCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTCTTGGGCGGCCGGCCCGCGCCCGTGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGCGGGTGGTAAATTTCATCTAAAGCTAAATACTGGCCGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGGTTAAAAGCACCTTGAAAAGGGAGTTAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCGGCCAGACTCGAGGGGCGGGGTTCAGCGGGTGCGCGTCACCCGTGCACTCCCCGTCCCCTCGGGCCAGCATCAGTTTCGACGGCCGGTCAAAGGCCCCCGGAATGTGTCGTCTCTAGGGACGTCTTATAGCCGGGGGTGCAATGCGGCCCGCCGGGACTGAGGAACGCGCTCCGGCTCGGATGCTGGCGTAATGGCCGTAAGCGG

Morphology After 7-10 days colonies velutinous, tannish-white; reverse rose-brown. Later, macroconidia smooth-walled to sparsely echinulate, thick-walled, irregularly spindle-shaped, of variable size and cell number, mostly with slightly bent, verrucose apex. Microconidia not observed
Name of Depositor YM Clayton
Isolation
Scalp hair of child
References

Clayton, YM. The changing pattern of tinea capitis in London school children. Mykosen (Suppl.) 1: 104-107, 1978.