Aspergillus fumigatus Fresenius (ATCC® 36607)

Strain Designations: 2085 [LSHB]  /  Product Format: freeze-dried

Permits and Restrictions

View Permits

Strain Designations 2085 [LSHB]
Application
Biomedical Research and Development Material
Emerging infectious disease research
Biosafety Level 2

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Comments
Chitin biosynthesis
polyene sensitivity
sterol metabolism
Morphology After 5-7 days colonies dark blue-green, consisting of a dense felt of conidiophores, intermingled with aerial hyphae. Conidial heads columnar; conidiogenous cells uniseriate. Conidiophore stipes smooth-walled, often green in the upper part. Vesicles subclavate, 20-30 µm wide. Conidia verrucose, (sub)spherical, 2.5-3.0 µm diam.
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

GGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACCGAGTGAGGGCCCTCTGGGTCCAACCTCCCACCCGTGTCTATCGTACCTTGTTGCTTCGGCGGGCCCGCCGTTTCGACGGCCGCCGGGGAGGCCTTGCGCCCCCGGGCCCGCGCCCGCCGAAGACCCCAACATGAACGCTGTTCTGAAAGTATGCAGTCTGAGTTGATTATCGTAATCAGTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCACGGCTTGTGTGTTGGGCCCCCGTCCCCCTCTCCCGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTTGTCACCTGCTCTGTAGGCCCGGCCGGCGCCAGCCGACACCCAACTTTATTTTTCTAAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAA


D1D2 region of the 28S ribosomal RNA gene

ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAAGAGCTCAAATTTGAAAGCTGGCCCCTTCGGGGTCCGCGTTGTAATTTGCAGAGGATGCTTCGGGTGCAGCCCCCGTCTAAGTGCCCTGGAACGGGCCGTCATAGAGGGTGAGAATCCCGTCTGGGACGGGGTGTCTGCGTCCGTGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATACTGGCCGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACTCGCCCGCGGGGTTCAGCCGGCATTCGTGCCGGTGTACTTCCCCGTGGGCGGGCCAGCGTCGGTTTGGGCGGCCGGTCAAAGGCCCTCGGAATGTATCACCTCTCGGGGTGTCTTATAGCCGAGGGTGCAATGCGGCCTGCCTGGACCGAGGAACGCGCTTCGGCTCGGACGCTGGCGTAATGGTCGTAAATGAC


beta-tubulin gene

AGGTGTGTGGATGAAACTCTTGATTTATACTATTTCGGCAACATCTCACGATCTGACTCGCTACTAGGCCAACGGTGACAAATATGTTCCTCGTGCCGTTCTGGTCGATCTCGAGCCTGGTACCATGGACGCTGTCCGTGCCGGTCCCTTCGGCGAGCTATTCCGTCCCGACAACTTCGTCTTCGGCCAGTCCGGTGCTGGTAACAACTGG

Morphology After 5-7 days colonies dark blue-green, consisting of a dense felt of conidiophores, intermingled with aerial hyphae. Conidial heads columnar; conidiogenous cells uniseriate. Conidiophore stipes smooth-walled, often green in the upper part. Vesicles subclavate, 20-30 µm wide. Conidia verrucose, (sub)spherical, 2.5-3.0 µm diam.
Name of Depositor D Kerridge
Chain of Custody
ATCC <-- D Kerridge <-- D. Archer <-- Mycol. Ref. Lab., LSHB
Isolation
Clinical isolate
Cross References

Nucleotide (GenBank) : M60301 A.fumigatus small subunit ribosomal RNA.

Nucleotide (GenBank) : M60300 Aspergillus fumigatus small subunit ribosomal RNA.

Nucleotide (GenBank) : AF222068 Aspergillus fumigatus cytochrome P450 sterol 14 alpha-demethylase

References

Russell NJ, et al. Sterol metabolism during germination of conidia of Aspergillus fumigatus. J. Gen. Microbiol. 101: 197-206, 1977. PubMed: 336840

Edlind TD, et al. Aspergillus fumigatus CYP51 sequence: potential basis for fluconazole resistance. Med Mycol 39: 299-302, 2001. PubMed: 11446535

Henry T, Iwen PC, Hinrichs SH. Identification of Aspergillus species using internal transcribed spacer regions 1 and 2. J. Clin. Microbiol. 38: 1510-1515, 2000. PubMed: 10747135

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation