Trichosporon asteroides (Rischin) Ota (ATCC® 34902)

Strain Designations: B1658  /  Product Format: freeze-dried

Deposited As Prototheca filamenta Arnold et Ahearn
Strain Designations B1658
Application
Biomedical Research and Development Material
Biosafety Level 2

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format freeze-dried
Type Strain no
Preceptrol® no
Medium ATCC® Medium 28: Emmons' modification of Sabouraud's agar
ATCC® Medium 200: YM agar or YM broth
ATCC® Medium 1245: YEPD
Growth Conditions
Temperature: 24°C to 26°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

GGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAGTGATTGCCTTAATTGGCTTATAACTATATCCACTTACACCTGTGAACTGTTCTACTACTTGACGCAAGTCGAGTATTTTTACAAACAATGTGTAATGAACGTCGTTTTATTATAACAAAATAAAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCAGCTTGCGCTCTCTGGTATTCCGGAGAGCATGCCTGTTTCAGTGTCATGAAATCTCAACCACTAGGGTTTCCTAATGGATTGGATTTGGGCGTCTGCGATCTCTGATCGCTCGCCTTAAAAGAGTTAGCAAGTTTGACATTAATGTCTGGTGTAATAAGTTTCACTGGGTCCATTGTGTTGAAGCGTGCTTCTAATCGTCCGCAAGGACAATTACTTTGACTCTGGCCTGAAATCAGGTAGGACTACCCGCTGAACTTAAGCATA

Name of Depositor L Ajello
Cross References

Nucleotide (GenBank) : KC881081 ITS including 5.8S rRNA gene