Trichosporon asteroides (Rischin) Ota, anamorph (ATCC® 34902)

Strain Designations: B1658  /  Product Format: freeze-dried

Permits and Restrictions

View Permits

Deposited As Prototheca filamenta Arnold et Ahearn
Strain Designations B1658
Application
Biomedical Research and Development Material
Biosafety Level 2
Product Format freeze-dried
Type Strain no
Preceptrol® no
Medium ATCC® Medium 28: Emmons' modification of Sabouraud's agar
ATCC® Medium 200: YM agar or YM broth
ATCC® Medium 1245: YEPD
Growth Conditions
Temperature: 24°C to 26°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

GGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAGTGATTGCCTTAATTGGCTTATAACTATATCCACTTACACCTGTGAACTGTTCTACTACTTGACGCAAGTCGAGTATTTTTACAAACAATGTGTAATGAACGTCGTTTTATTATAACAAAATAAAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCAGCTTGCGCTCTCTGGTATTCCGGAGAGCATGCCTGTTTCAGTGTCATGAAATCTCAACCACTAGGGTTTCCTAATGGATTGGATTTGGGCGTCTGCGATCTCTGATCGCTCGCCTTAAAAGAGTTAGCAAGTTTGACATTAATGTCTGGTGTAATAAGTTTCACTGGGTCCATTGTGTTGAAGCGTGCTTCTAATCGTCCGCAAGGACAATTACTTTGACTCTGGCCTGAAATCAGGTAGGACTACCCGCTGAACTTAAGCATA

Name of Depositor L Ajello
Cross References

Nucleotide (GenBank) : KC881081 ITS including 5.8S rRNA gene

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation