Trichosporon jirovecii Fragner (ATCC® 34499)

Strain Designations: CCY 30-7-1 [ATCC 90047, CBS 6864]  /  Product Format: freeze-dried

Permits and Restrictions

View Permits

Deposited As Trichosporon jirovecii Fragner
Strain Designations CCY 30-7-1 [ATCC 90047, CBS 6864]
Application
Biomedical Research and Development Material
Biosafety Level 2

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain yes
Preceptrol® no
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence (including the D1D2 region)

GTTTCCGTAGGTGAACCTGCGGAAGGATCATTAGTGAATTGCTCTTTGAGCGTTAACTACATCCATCTACACCTGTGAACTGTTGATTGACTCCGGTCAATTACTTTACAAACATTGTGTAATGAACGTCATGTTATTATAACAAAAATAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCAACTTGCGCTCTCTGGTATTCCGGAGAGCATGCCTGTTTGAGTATCATGAAATCTCAACCATTAGGGTTTCTTAATGGCTTGGATTTGGGCGCTGCCACTTGCCTGGCTCGCCTTAAAAGAGTTAGCGTGTTTAACTTGTCGATCTGGCGTAATAAGTTTCGCTGGTGTAGACTTGAGAAGTGCGCTTCTAATCGTCTTCGGACAATTCTTGAACTCTGGTCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCTTTAGTAACGGCGAGTGAACCGGGAAAAGCTCAAATTTGTAATCTGGCTGTCTTCGATAGTCCGAGTTGTAATCTATAGACGTGTTTTCCGTGCTGGATCGTATCTAAGTCCCTTGGAACAGGGTATCAAAGAGGGTGACAATCCCGTGCTTGATACGACGACCAGTGCTCTGTGATACACGTTCTACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGATTGAAGTCAGTCGTGTTCTTCAGATTCAGCTGGTTCTTCCAGTCTACTTCTGTTGAACGGGTCAACATCAGTTTTGTCCGGTGGATAAAGGTAGTAGGAATGTGACTCCCCCGGGAGTGTTATAGCCTATTATTGCATACACTGGGTGAGACTGAGGACTGCAGCTCGCCTTTTGGCCGGTCTTCGGACACGTTCGAGCTTAGGATGTTGACATAATGGCTTTAAACGAC

Name of Depositor CCY
Chain of Custody
ATCC <-- CCY <-- P. Fragner
Isolation
Human toenail, Czechoslovakia
Cross References

Nucleotide (GenBank) : AF105398 26S ribosomal RNA gene, partial sequence

Nucleotide (GenBank) : AF218982 Trichosporon jirovecii strain ATCC 34499T 5.8S ribosomal RNA gene,

Nucleotide (GenBank) : HM802131 ITS including 5.8S rRNA gene and D1/D2 region of 26S rRNA gene

References

Fragner P. Trichosporon jirovecii sp. nov.. Ceska Mykol. 23: 160-162, 1969.

Fell JW, et al. Biodiversity and systematics of basidiomycetous yeasts as determined by large-subunit rDNA D1/D2 domain sequence analysis. Int. J. Syst. Evol. Microbiol. 50: 1351-1371, 2000. PubMed: 10843082

King DS, Jong SC. A contribution to the genus Trichosporon. Mycotaxon 6: 391-417, 1977.

Hamano K, et al. Genome profiling (GP) as an effective tool for monitoring culture collections: A case study with Trichosporon. J. Microbiol Methods 89: 119-128, 2012. PubMed: 22401825

Gujjari P, et al. Characterization of oleaginous yeasts revealed two novel species: Trichosporon cacaoliposimilis sp. nov. and Trichosporon oleaginosus sp. nov. Mycologia. 103:1110-1118, 2011. PubMed: 21558504

Sugita T, et al. Sequence analysis of the ribosomal DNA intergenic spacer 1 regions of Trichosporon species. J. Clin. Microbiol. 45: 1826-1830, 2002.

Scorzetti G, et al. Systematics of basidiomycetous yeasts: a comparison of large subunit D1/D2 and internal transcribed spacer rDNA regions. FEMS Yeast Res. 2: 495–517, 2002. PubMed: 12702266

Chen YC, et al. Polymorphic internal transcribed spacer region 1 DNA sequences identify medically important yeasts. J. Clin. Microbiol. 39: 4042-4051, 2001. PubMed: 11682528

Chen YC, et al. Identification of medically important yeasts using PCR-based detection of DNA sequence polymorphisms in the internal transcribed spacer 2 region of the rRNA genes. J. Clin. Microbiol. 38: 2302-2310, 2000. PubMed: 10834993

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation