Phialophora verrucosa Medlar, anamorph (ATCC® 34159)

Strain Designations: P152-8 [CBS 839.69]  /  Product Format: freeze-dried

Strain Designations P152-8 [CBS 839.69]
Application
Biomedical Research and Development Material
Biosafety Level 2

Biosafety  classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format freeze-dried
Type Strain no
Preceptrol® no
Morphology

After 10 days colonies olivaceous grey, velvety, reverse dark brown to black. Conidiophores poorly differentiated, light brown or olivaceous, giving rise to conidiogenous cells laterally and terminally. Conidiogenous cells discrete, mostly flask-shaped, light brown or olivaceous, 10-25 x 4-5 µm, producing conidia enteroblastically. Conidia hyaline, broad-ellipsoidal, 3-6 x 1,5-3 µm, aggregating in heads.

Medium ATCC® Medium 325: Malt extract agar (Blakeslee's formula)
Growth Conditions
Temperature: 26.0°C
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal   transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.

TGATATGCTTAAGTTCAGCGCGTATTCCTACCTGATCCGAGGTCACCTTGAAGAAATTTCCTGGTTAAAGGAGAAAGACCGGGTCCTGGGCGCCCTTGTCCGATACGTGCTCAGTTAAAAGCTCAGTGTACCGGGGGATCCACAGGCCGCCGTCATTGTCTTTAGGAGGGGTCGGTATCACACGACCAAAATCCGTCCAACACCAAGCACGGGGCTTGAGGGGTGATAATGACGCTCGAACAGGCATGCCCTTTGGAATACCAAAGGGCGCAATGTGCGTTCAAAGATTCGATGACTCACGGGAATTCTGCAATTCGCATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCCAGAACCAAGAGATCCGTTGTTGAAAGTTTTTGCTTTTGATTTAATCACAAGACTCAGACATAATACACGATTCATCCAAGAGTTTAGGTTGGCTATCGGCGGACACGGGCCTAGGGACGCCTCTCAGCGGTCCCAGGGCGGTCGTGAGACGGGCCCGCCAAAGCAACATGCAGCAAGGTAAACACAGGGTTGGGAGGTCGGGCCTGGAGAGACCCTAACTCGTTAATGATCCTT

Morphology

After 10 days colonies olivaceous grey, velvety, reverse dark brown to black. Conidiophores poorly differentiated, light brown or olivaceous, giving rise to conidiogenous cells laterally and terminally. Conidiogenous cells discrete, mostly flask-shaped, light brown or olivaceous, 10-25 x 4-5 µm, producing conidia enteroblastically. Conidia hyaline, broad-ellipsoidal, 3-6 x 1,5-3 µm, aggregating in heads.

Name of Depositor T Nilsson
Isolation
Pulpwood chips, Betula verrucosa and B. pubescens, Sweden.
References

Nilsson T. Studies on wood degradation and cellulolytic activity of micro fungi. Stud. For. Suec. 104: 1-40, 1973.

Nilsson T. The degradation of cellulose and the production of cellulase, xylanase, mannanase, and amylase by wood-attacking microfungi. Stud. For. Suec. 114: 1-61, 1974.

Nilsson T. Microscopic studies on the degradation of cellophane and various cellulosic fibres by wood-attacking microfungi. Stud. For. Suec. 117: 1-32, 1974.